ID: 1072147506

View in Genome Browser
Species Human (GRCh38)
Location 10:92655466-92655488
Sequence GTACCTGCATAGTTTATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072147506_1072147508 -8 Left 1072147506 10:92655466-92655488 CCCAAAATAAACTATGCAGGTAC 0: 1
1: 0
2: 2
3: 15
4: 189
Right 1072147508 10:92655481-92655503 GCAGGTACCACCAAAGAAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 157
1072147506_1072147511 11 Left 1072147506 10:92655466-92655488 CCCAAAATAAACTATGCAGGTAC 0: 1
1: 0
2: 2
3: 15
4: 189
Right 1072147511 10:92655500-92655522 AAGGAGCCTAGTAAACTTGCAGG 0: 1
1: 0
2: 1
3: 5
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072147506 Original CRISPR GTACCTGCATAGTTTATTTT GGG (reversed) Intergenic
903638861 1:24842688-24842710 GTACCCGCTTGGTTTTTTTTTGG + Exonic
904047603 1:27617949-27617971 GTACCTGCACAGTTGGTTTAGGG - Intronic
905324391 1:37140508-37140530 TTATCTCCATAGGTTATTTTAGG - Intergenic
908178757 1:61583061-61583083 GTACCTACACAATTCATTTTAGG - Intergenic
908681073 1:66661545-66661567 GTAGCTGCCTATTTTATTTTTGG - Intronic
910084726 1:83386256-83386278 ATACCTGCAAGCTTTATTTTGGG - Intergenic
911286499 1:96000303-96000325 TTACCTAAATATTTTATTTTTGG - Intergenic
911459515 1:98171975-98171997 GTCCCTTCATTGTTTATTTCAGG + Intergenic
911463211 1:98216413-98216435 GTATCTGCATAACTTATTTGGGG - Intergenic
911578163 1:99602977-99602999 GTAAAAGCATGGTTTATTTTTGG + Intergenic
911603838 1:99877888-99877910 TTACCTGCATAGTTTACTTAAGG - Intronic
913508911 1:119544923-119544945 GTACGTGTATACTTTAATTTTGG - Intergenic
916709250 1:167387860-167387882 ATCCATGTATAGTTTATTTTGGG - Intronic
918710619 1:187724190-187724212 GTACCTTAAAATTTTATTTTAGG + Intergenic
921192962 1:212725910-212725932 TTAATTTCATAGTTTATTTTAGG - Intergenic
921446366 1:215251477-215251499 TTACCTGCAGAGATTATTCTTGG - Intergenic
921634296 1:217474734-217474756 TTACCTGCTTGGTATATTTTGGG + Intronic
921662380 1:217820176-217820198 GTACCTGCATATTCTATATCCGG - Intronic
922603837 1:226876493-226876515 GTATCTGTAGGGTTTATTTTAGG - Intronic
922689330 1:227675299-227675321 GTGCTAGCATAGTTTATTTCTGG - Intronic
1063025298 10:2172498-2172520 GCAACTGCATAGTTTTTATTCGG - Intergenic
1064161058 10:12947021-12947043 CTATCTCCACAGTTTATTTTCGG + Intronic
1065394175 10:25216523-25216545 GTTCCTCCAAAGTTAATTTTGGG + Intronic
1065456614 10:25912761-25912783 GTACTTGCACAATTTATTTTTGG - Intergenic
1066282199 10:33928273-33928295 CTGCCTGCATAGTTTAACTTTGG - Intergenic
1068507686 10:57923367-57923389 TTCCCATCATAGTTTATTTTGGG - Intergenic
1068672492 10:59738009-59738031 CTACCTGCCTTTTTTATTTTGGG - Intergenic
1069586732 10:69610414-69610436 ACACCTGAATATTTTATTTTGGG - Intergenic
1070996913 10:80792739-80792761 GTACCTAAGTACTTTATTTTTGG + Intergenic
1072147506 10:92655466-92655488 GTACCTGCATAGTTTATTTTGGG - Intergenic
1073548799 10:104377778-104377800 TTCCCTGAATAGTCTATTTTAGG - Intronic
1073988627 10:109238671-109238693 GTACTTGGATAATTTATTTTAGG + Intergenic
1074397547 10:113110722-113110744 GTACTTCCATACTTAATTTTAGG - Intronic
1074706901 10:116141231-116141253 GTACCTGCATTGTTCATTTTGGG - Intronic
1075342026 10:121654721-121654743 GGAACTGCATCGTTAATTTTTGG - Intergenic
1075752752 10:124786902-124786924 TTACCTGTATAGGTTCTTTTGGG - Intronic
1075827531 10:125371943-125371965 TTACCTGCATATTTTAATTGAGG - Intergenic
1078211273 11:9271675-9271697 GTATATGCATAGTCTATTTTTGG + Intergenic
1079648680 11:22898856-22898878 GTAGCTGCATATTCTATATTAGG - Intergenic
1079746196 11:24133546-24133568 GTATCTGGTTAGCTTATTTTGGG + Intergenic
1084292332 11:68181974-68181996 GTACTTCCACAGGTTATTTTAGG + Intronic
1084467149 11:69330919-69330941 GATCCAGTATAGTTTATTTTAGG - Intronic
1086109300 11:83181205-83181227 GTGCCTCCATAGTATCTTTTAGG + Intronic
1087836735 11:102882469-102882491 GAACATGCATGGTTTATTTTTGG - Intergenic
1092980089 12:13786153-13786175 GTACCTGCTTAGTTTAGTCGAGG - Intronic
1093469668 12:19487053-19487075 GTATCTGAATATTCTATTTTGGG + Intronic
1095118880 12:38389520-38389542 TTACATGCATAGGTTAATTTAGG - Intergenic
1095192676 12:39275678-39275700 CTCACTGCATAGGTTATTTTAGG - Intergenic
1095865180 12:46964036-46964058 GTACCTGCATAGGTCATACTGGG + Intergenic
1098492994 12:71104039-71104061 TTAACAGCATAGTTTCTTTTTGG - Intronic
1099311331 12:81028210-81028232 AAACCTGCATATTCTATTTTTGG + Intronic
1100832709 12:98531632-98531654 GTACCTGTATTGTTTCATTTAGG - Intronic
1103780254 12:123393920-123393942 GTTCCTGCATAGATTTTTTTGGG + Intronic
1108302885 13:49097607-49097629 GTACAGGCCTAGTTTCTTTTTGG + Intronic
1108398424 13:50013279-50013301 GAACATGTATAGATTATTTTTGG - Intronic
1108445217 13:50501720-50501742 ATACCTGGATACTTTAATTTGGG - Intronic
1109793778 13:67283551-67283573 TTACTTTCATAGTATATTTTGGG - Intergenic
1109835549 13:67851864-67851886 GTAGCTAAATAGTTTATTTCAGG + Intergenic
1110097014 13:71538913-71538935 GTAATTTCAGAGTTTATTTTAGG + Intronic
1110252451 13:73395750-73395772 GAAACAGCATACTTTATTTTTGG - Intergenic
1110801623 13:79703621-79703643 GTGCCAGCAGATTTTATTTTTGG + Intergenic
1112429331 13:99336847-99336869 GTACCTGCATGGTGGATTATGGG - Intronic
1112915484 13:104544929-104544951 GTACCTGACTTGTTTATTTGAGG + Intergenic
1116793320 14:49362933-49362955 GTACACACATAGTTTGTTTTAGG - Intergenic
1118072724 14:62263412-62263434 GTCCCAGCAGAGTTTCTTTTTGG - Intergenic
1118908296 14:70039632-70039654 GTACCAGAATAGTTTACCTTGGG + Intergenic
1119684628 14:76621818-76621840 GAAGCTGCAGAGTTTACTTTAGG - Intergenic
1120270188 14:82302802-82302824 ATATCTACATATTTTATTTTTGG + Intergenic
1120600341 14:86496758-86496780 GTTTCTCCATTGTTTATTTTTGG + Intergenic
1127305779 15:57704647-57704669 GGACCTTCAAATTTTATTTTTGG - Intronic
1130121735 15:81055441-81055463 GTACCTTGATAATATATTTTAGG + Intronic
1130748068 15:86677290-86677312 GTACATGCATGCTTTGTTTTTGG + Intronic
1132947292 16:2538425-2538447 GTGCCTGGAAAGTTTGTTTTCGG + Intronic
1132968424 16:2673031-2673053 GTGCCTGGAAAGTTTGTTTTCGG - Intergenic
1137252288 16:46749004-46749026 ATACCTGCATAGTTGTTATTGGG - Intronic
1137357055 16:47777164-47777186 GAACCTGCCTAGATTATTTGAGG + Intergenic
1137520175 16:49187214-49187236 ACACATGCATAGTTTATTTTGGG - Intergenic
1137592028 16:49699624-49699646 GTATCTTCATTGTTTACTTTGGG + Intronic
1139070666 16:63377942-63377964 TTAGCTTCAAAGTTTATTTTAGG + Intergenic
1139367311 16:66441471-66441493 GTACCTGGCAAGCTTATTTTGGG - Intronic
1141861931 16:86723111-86723133 GTCCCTGCATTATTCATTTTTGG + Intergenic
1144183511 17:12774503-12774525 GTACTTTCATCTTTTATTTTAGG - Intergenic
1149690689 17:58573207-58573229 GTAGGTGCATGGTTTATTTTGGG + Exonic
1152193152 17:78900810-78900832 GTACTTGCATAGTTGGATTTAGG - Intronic
1157868999 18:51212137-51212159 GCACCATCATAGTTCATTTTAGG - Intronic
1159508390 18:69364378-69364400 ATACCTGCACAGATAATTTTTGG + Intergenic
1160052466 18:75447765-75447787 GTACCTGTAAGGTTAATTTTAGG - Intergenic
1161184798 19:2910191-2910213 ATACCTGTATGTTTTATTTTAGG + Intronic
1167292799 19:48633792-48633814 GAACCTTCATATTTTATATTAGG - Intronic
925445264 2:3921906-3921928 GTAACTGGCTACTTTATTTTTGG + Intergenic
928462405 2:31486533-31486555 GTACCTGGATATTTTAGTTGAGG + Intergenic
928582212 2:32720152-32720174 GTATGTGTATGGTTTATTTTTGG + Intronic
929596150 2:43177616-43177638 CTTCTTGCATACTTTATTTTTGG - Intergenic
930412162 2:51038701-51038723 GTACCTGCATGATATATGTTGGG + Intergenic
932509895 2:72275845-72275867 TTACCTGCTTAATTTTTTTTGGG + Intronic
932788896 2:74634958-74634980 GTACCACCTTAGTCTATTTTGGG + Intronic
935364411 2:102274516-102274538 GGACCTCCAAATTTTATTTTTGG - Intergenic
937779037 2:125816115-125816137 GTACCTCCATAGTTGTTTTCAGG - Intergenic
938749993 2:134319204-134319226 GTAACTGTATTGTTAATTTTGGG + Intronic
939625311 2:144469649-144469671 GTACCTGAAAAAGTTATTTTGGG + Intronic
941072902 2:160974758-160974780 ATACCTGGACATTTTATTTTTGG + Intergenic
941217542 2:162732353-162732375 GTACCTGCTTAACTTACTTTCGG - Intronic
941268455 2:163394144-163394166 GTGCATGCATAGTTGATTATAGG + Intergenic
942140880 2:172976687-172976709 TTACCTGCATATTTTACTATGGG + Intronic
943224764 2:185157595-185157617 GTACCTAGATATTTCATTTTTGG + Intergenic
944352230 2:198742428-198742450 GTACCTGCTTAAATCATTTTGGG - Intergenic
948435039 2:237947351-237947373 ATGCCGGCATAGTGTATTTTGGG - Intergenic
1169015251 20:2287357-2287379 GTATCTGCATAGATTATGTGTGG + Intergenic
1170099820 20:12686816-12686838 GGACATGAATAGTTCATTTTTGG - Intergenic
1170174108 20:13448619-13448641 CTACTTGCGTATTTTATTTTAGG - Intronic
1172410415 20:34717729-34717751 GGACCTGAAGAGTTGATTTTAGG - Intronic
1173734883 20:45353348-45353370 GTCTCTGCATACATTATTTTGGG + Intergenic
1177794727 21:25761935-25761957 GTACCTAAATAATTTAATTTTGG + Intronic
1177803510 21:25851127-25851149 TTACCTACTTTGTTTATTTTAGG + Intergenic
1178996024 21:37400799-37400821 GTACAATCATAGTATATTTTTGG - Intronic
1179537635 21:42062709-42062731 GTTCCGGCAGAGTTTATTTGGGG - Intergenic
1182033220 22:27176369-27176391 GTATGTGCATAGTATATTTCAGG - Intergenic
949353641 3:3153420-3153442 TTACCTGAATATTTCATTTTTGG + Exonic
949582053 3:5398377-5398399 GTACCAGCATGGTTGGTTTTGGG + Intergenic
950959106 3:17085826-17085848 ATACCTGAATATTTTATTTCTGG - Intronic
955646807 3:61148312-61148334 ATAACTGCATACTTTGTTTTAGG - Intronic
956127535 3:66025184-66025206 GTGACTGCAAAATTTATTTTTGG - Intronic
957362305 3:79175122-79175144 TTAGCTGGATAGTTTATTTTAGG + Intronic
959979476 3:112499243-112499265 GCACCTGCTTAGGTTATTTCTGG - Intronic
962033460 3:131625759-131625781 GTGCCTGCATTGATTGTTTTTGG - Intronic
962126284 3:132622600-132622622 ATATCTGCAAAGTTTATTTGTGG + Intronic
963686511 3:148441759-148441781 TAACCAGCATATTTTATTTTTGG + Intergenic
963703561 3:148657280-148657302 GCATCTGAAGAGTTTATTTTTGG - Intergenic
964415753 3:156445761-156445783 GTAACCGCATAGTTTATTTTTGG - Intronic
965570851 3:170171066-170171088 ATCCCTGCATTGTATATTTTAGG + Intronic
966951119 3:184818667-184818689 TTACATGCAAATTTTATTTTTGG - Intronic
968332915 3:197886835-197886857 TTCCTTGCATAGTATATTTTTGG - Intronic
970625897 4:17881495-17881517 GTACTTGTATTATTTATTTTTGG - Exonic
971272694 4:25165586-25165608 GTAAGACCATAGTTTATTTTGGG - Intronic
972295880 4:37737533-37737555 GGAACTGCACAGTTTCTTTTTGG - Intergenic
974849676 4:67389507-67389529 GTGCCTGCATCCTTTATTATGGG + Intergenic
975383904 4:73733022-73733044 GTACCTGCTTCATTTATCTTTGG + Intergenic
976976435 4:91170280-91170302 GTAGCTGCATATTTAATTTAAGG - Intronic
980559248 4:134451247-134451269 GACCCTGCATAGGTCATTTTTGG + Intergenic
982805540 4:159758389-159758411 GTTTCTCCATGGTTTATTTTTGG + Intergenic
984510659 4:180674766-180674788 GCACCTGCTTAGGTGATTTTTGG - Intergenic
984819804 4:183871842-183871864 ATAGCTGCATATTTTTTTTTTGG - Intronic
984998317 4:185459263-185459285 GTATCTGCACAGATTCTTTTAGG + Exonic
986977826 5:13412758-13412780 TTACCAGCATCGTGTATTTTGGG + Intergenic
988012162 5:25502463-25502485 ATACTTACATATTTTATTTTTGG + Intergenic
988099215 5:26656685-26656707 CTACCTGCATGGTGTATTCTGGG + Intergenic
991411810 5:66353380-66353402 GAACCTGCAGAGTGTATTGTGGG - Intergenic
993099374 5:83518480-83518502 GTACCCACATAATGTATTTTAGG - Intronic
993434480 5:87874624-87874646 GTATTTGTATATTTTATTTTAGG + Intergenic
993538313 5:89116413-89116435 GTTACTTCATATTTTATTTTGGG + Intergenic
995233331 5:109796561-109796583 GTTCCTGCCTACTTTATTTCTGG - Intronic
996007596 5:118441609-118441631 CTACCTGCATTGTTGTTTTTAGG - Intergenic
997333526 5:133085686-133085708 TTGTCTGCATAGTTTTTTTTGGG - Intronic
1001729792 5:173943600-173943622 GTACCTGAATAACTTATTCTTGG + Intronic
1004571986 6:16855206-16855228 CCACATGCATAGTTTATTTGTGG + Intergenic
1005148464 6:22720416-22720438 GTACCTGCATTGTTGATTCCTGG + Intergenic
1006678422 6:35779799-35779821 GTACCTGGAGAGTGTATGTTGGG + Intergenic
1007939672 6:45768303-45768325 GTACCCTCAGATTTTATTTTAGG + Intergenic
1009736096 6:67677063-67677085 GTACATGCGTTGTGTATTTTAGG - Intergenic
1011908031 6:92397215-92397237 GGACAGGCAAAGTTTATTTTAGG + Intergenic
1013351266 6:109308059-109308081 CTACCTGCATATTATATTCTAGG - Intergenic
1013708106 6:112863414-112863436 GTAGCTTAATAGTTTATCTTTGG - Intergenic
1013949450 6:115762155-115762177 GTAAATGCATAGTTTATTTCTGG - Intergenic
1014801389 6:125781818-125781840 GTATGTGCATAGATTATTTCTGG - Intronic
1014955565 6:127611248-127611270 GTACCAACATAGTTTCTTTATGG + Intergenic
1016173704 6:141051772-141051794 GTCTCTGCCTAGTTTATGTTTGG - Intergenic
1016398585 6:143653486-143653508 CCACATGCAAAGTTTATTTTCGG + Intronic
1016494521 6:144645138-144645160 GTCCCTCTATTGTTTATTTTAGG + Intronic
1018111603 6:160541628-160541650 TTACCTGAAAAGTTTACTTTTGG + Intronic
1023306051 7:38828171-38828193 GTACATACAAGGTTTATTTTGGG - Intronic
1024464500 7:49697602-49697624 GTAAATGCATAGTTCATTTCTGG + Intergenic
1024773110 7:52748884-52748906 GTAGCTTCATTGTGTATTTTGGG - Intergenic
1027301548 7:76842369-76842391 ATACCTGCAAGCTTTATTTTGGG - Intergenic
1028927090 7:96369995-96370017 GTTCTTGGATATTTTATTTTGGG + Intergenic
1030416178 7:109246407-109246429 ATGCCTGCATAATTTTTTTTTGG + Intergenic
1031405134 7:121376202-121376224 GAACCTGGATACTTCATTTTAGG + Intronic
1033316524 7:140302107-140302129 GTCCGTGCATAATTTATTTCTGG - Intronic
1033978868 7:147139058-147139080 CTACATGCATATATTATTTTTGG - Intronic
1034864030 7:154625266-154625288 ATAGCTGCTTAGTTTATTCTTGG - Intronic
1035911382 8:3570715-3570737 CTACCTCCATAGGGTATTTTTGG - Intronic
1041108617 8:54465832-54465854 GTACCTGCATGGCTAATTTTAGG + Intergenic
1041457884 8:58079850-58079872 CTACCTGCATAGTTTATTAGTGG + Intronic
1041879140 8:62727605-62727627 ATACCTATATAGTTCATTTTGGG - Intronic
1043066458 8:75577108-75577130 TTACCTTCAGAATTTATTTTTGG - Intergenic
1043224487 8:77707094-77707116 GTACCTACATTTTTTTTTTTTGG - Intergenic
1044037885 8:87328236-87328258 TTTCCTTCATTGTTTATTTTTGG + Intronic
1045163028 8:99570484-99570506 GTAACTGTATTTTTTATTTTTGG + Intronic
1045808858 8:106198339-106198361 CCACCTGCATAATTTCTTTTTGG + Intergenic
1046353144 8:113042431-113042453 GTACCTGCACATTTTCTTTTAGG + Intronic
1047363447 8:124190764-124190786 GTCCCTGCATAGGTTACTTCTGG - Intergenic
1048418995 8:134258511-134258533 GTAACTGCCTAATTCATTTTGGG + Intergenic
1048898298 8:139014685-139014707 GTTACTGTATATTTTATTTTAGG + Intergenic
1050867099 9:10515513-10515535 GTTTCAGCATATTTTATTTTAGG + Intronic
1051307875 9:15734692-15734714 GGACCTGTAAATTTTATTTTAGG + Intronic
1052564850 9:30136437-30136459 TTACCTTCCTAGTTTAATTTAGG - Intergenic
1055915001 9:81391836-81391858 ATTCCTGCATAGTCTACTTTTGG - Intergenic
1057147792 9:92770183-92770205 GTGCCTTCAAATTTTATTTTTGG + Intergenic
1058527171 9:105871101-105871123 GGATCTGCATAGTTGACTTTGGG + Intergenic
1058866965 9:109169548-109169570 TTACCTGCAAACTTCATTTTAGG - Intergenic
1059771993 9:117435312-117435334 GTACCTTCATACTTAATGTTGGG - Intergenic
1187012308 X:15292731-15292753 ATACTTTCATAGTTTATTTTAGG + Intronic
1188060447 X:25594834-25594856 TTGCCTGTAAAGTTTATTTTGGG + Intergenic
1188208966 X:27395368-27395390 GTATAGGTATAGTTTATTTTAGG - Intergenic
1193058541 X:77180324-77180346 GTACATGTACAGTTTTTTTTAGG + Intergenic
1200342266 X:155409906-155409928 ATTCCTCCATATTTTATTTTTGG + Intergenic
1200362233 X:155620623-155620645 CTACCAGCATAATTTAATTTTGG - Intronic
1201727486 Y:17169936-17169958 GTACTTCAATAGTTTATTTAGGG - Intergenic