ID: 1072151561

View in Genome Browser
Species Human (GRCh38)
Location 10:92689261-92689283
Sequence CTCCACCTGGTTTCATTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072151561_1072151568 26 Left 1072151561 10:92689261-92689283 CCTCCAAATGAAACCAGGTGGAG No data
Right 1072151568 10:92689310-92689332 TCCAGCCATCCGAATCCCGCCGG No data
1072151561_1072151570 27 Left 1072151561 10:92689261-92689283 CCTCCAAATGAAACCAGGTGGAG No data
Right 1072151570 10:92689311-92689333 CCAGCCATCCGAATCCCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072151561 Original CRISPR CTCCACCTGGTTTCATTTGG AGG (reversed) Intergenic
No off target data available for this crispr