ID: 1072151562

View in Genome Browser
Species Human (GRCh38)
Location 10:92689264-92689286
Sequence CCGCTCCACCTGGTTTCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072151562_1072151568 23 Left 1072151562 10:92689264-92689286 CCAAATGAAACCAGGTGGAGCGG No data
Right 1072151568 10:92689310-92689332 TCCAGCCATCCGAATCCCGCCGG No data
1072151562_1072151570 24 Left 1072151562 10:92689264-92689286 CCAAATGAAACCAGGTGGAGCGG No data
Right 1072151570 10:92689311-92689333 CCAGCCATCCGAATCCCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072151562 Original CRISPR CCGCTCCACCTGGTTTCATT TGG (reversed) Intergenic
No off target data available for this crispr