ID: 1072151565

View in Genome Browser
Species Human (GRCh38)
Location 10:92689287-92689309
Sequence GTTCAGGTGCTGCGGACTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072151565_1072151573 13 Left 1072151565 10:92689287-92689309 CCAAGAGTCCGCAGCACCTGAAC No data
Right 1072151573 10:92689323-92689345 ATCCCGCCGGGCCGCAGCTAAGG No data
1072151565_1072151570 1 Left 1072151565 10:92689287-92689309 CCAAGAGTCCGCAGCACCTGAAC No data
Right 1072151570 10:92689311-92689333 CCAGCCATCCGAATCCCGCCGGG No data
1072151565_1072151574 14 Left 1072151565 10:92689287-92689309 CCAAGAGTCCGCAGCACCTGAAC No data
Right 1072151574 10:92689324-92689346 TCCCGCCGGGCCGCAGCTAAGGG No data
1072151565_1072151568 0 Left 1072151565 10:92689287-92689309 CCAAGAGTCCGCAGCACCTGAAC No data
Right 1072151568 10:92689310-92689332 TCCAGCCATCCGAATCCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072151565 Original CRISPR GTTCAGGTGCTGCGGACTCT TGG (reversed) Intergenic
No off target data available for this crispr