ID: 1072151570

View in Genome Browser
Species Human (GRCh38)
Location 10:92689311-92689333
Sequence CCAGCCATCCGAATCCCGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072151564_1072151570 14 Left 1072151564 10:92689274-92689296 CCAGGTGGAGCGGCCAAGAGTCC No data
Right 1072151570 10:92689311-92689333 CCAGCCATCCGAATCCCGCCGGG No data
1072151565_1072151570 1 Left 1072151565 10:92689287-92689309 CCAAGAGTCCGCAGCACCTGAAC No data
Right 1072151570 10:92689311-92689333 CCAGCCATCCGAATCCCGCCGGG No data
1072151561_1072151570 27 Left 1072151561 10:92689261-92689283 CCTCCAAATGAAACCAGGTGGAG No data
Right 1072151570 10:92689311-92689333 CCAGCCATCCGAATCCCGCCGGG No data
1072151562_1072151570 24 Left 1072151562 10:92689264-92689286 CCAAATGAAACCAGGTGGAGCGG No data
Right 1072151570 10:92689311-92689333 CCAGCCATCCGAATCCCGCCGGG No data
1072151566_1072151570 -7 Left 1072151566 10:92689295-92689317 CCGCAGCACCTGAACTCCAGCCA No data
Right 1072151570 10:92689311-92689333 CCAGCCATCCGAATCCCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072151570 Original CRISPR CCAGCCATCCGAATCCCGCC GGG Intergenic
No off target data available for this crispr