ID: 1072151573

View in Genome Browser
Species Human (GRCh38)
Location 10:92689323-92689345
Sequence ATCCCGCCGGGCCGCAGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072151565_1072151573 13 Left 1072151565 10:92689287-92689309 CCAAGAGTCCGCAGCACCTGAAC No data
Right 1072151573 10:92689323-92689345 ATCCCGCCGGGCCGCAGCTAAGG No data
1072151566_1072151573 5 Left 1072151566 10:92689295-92689317 CCGCAGCACCTGAACTCCAGCCA No data
Right 1072151573 10:92689323-92689345 ATCCCGCCGGGCCGCAGCTAAGG No data
1072151564_1072151573 26 Left 1072151564 10:92689274-92689296 CCAGGTGGAGCGGCCAAGAGTCC No data
Right 1072151573 10:92689323-92689345 ATCCCGCCGGGCCGCAGCTAAGG No data
1072151567_1072151573 -3 Left 1072151567 10:92689303-92689325 CCTGAACTCCAGCCATCCGAATC No data
Right 1072151573 10:92689323-92689345 ATCCCGCCGGGCCGCAGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072151573 Original CRISPR ATCCCGCCGGGCCGCAGCTA AGG Intergenic
No off target data available for this crispr