ID: 1072151574

View in Genome Browser
Species Human (GRCh38)
Location 10:92689324-92689346
Sequence TCCCGCCGGGCCGCAGCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072151569_1072151574 -10 Left 1072151569 10:92689311-92689333 CCAGCCATCCGAATCCCGCCGGG No data
Right 1072151574 10:92689324-92689346 TCCCGCCGGGCCGCAGCTAAGGG No data
1072151567_1072151574 -2 Left 1072151567 10:92689303-92689325 CCTGAACTCCAGCCATCCGAATC No data
Right 1072151574 10:92689324-92689346 TCCCGCCGGGCCGCAGCTAAGGG No data
1072151566_1072151574 6 Left 1072151566 10:92689295-92689317 CCGCAGCACCTGAACTCCAGCCA No data
Right 1072151574 10:92689324-92689346 TCCCGCCGGGCCGCAGCTAAGGG No data
1072151565_1072151574 14 Left 1072151565 10:92689287-92689309 CCAAGAGTCCGCAGCACCTGAAC No data
Right 1072151574 10:92689324-92689346 TCCCGCCGGGCCGCAGCTAAGGG No data
1072151564_1072151574 27 Left 1072151564 10:92689274-92689296 CCAGGTGGAGCGGCCAAGAGTCC No data
Right 1072151574 10:92689324-92689346 TCCCGCCGGGCCGCAGCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072151574 Original CRISPR TCCCGCCGGGCCGCAGCTAA GGG Intergenic
No off target data available for this crispr