ID: 1072160395

View in Genome Browser
Species Human (GRCh38)
Location 10:92760907-92760929
Sequence GGTACCAAGGCACTCAATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072160390_1072160395 24 Left 1072160390 10:92760860-92760882 CCTCAGGTTCACATTCTCTGCTT No data
Right 1072160395 10:92760907-92760929 GGTACCAAGGCACTCAATTTTGG No data
1072160389_1072160395 27 Left 1072160389 10:92760857-92760879 CCTCCTCAGGTTCACATTCTCTG No data
Right 1072160395 10:92760907-92760929 GGTACCAAGGCACTCAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072160395 Original CRISPR GGTACCAAGGCACTCAATTT TGG Intergenic
No off target data available for this crispr