ID: 1072165830

View in Genome Browser
Species Human (GRCh38)
Location 10:92812266-92812288
Sequence TGCCATTTGCAGAAAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072165827_1072165830 1 Left 1072165827 10:92812242-92812264 CCTTTGTCACTGGAATATCTCCT No data
Right 1072165830 10:92812266-92812288 TGCCATTTGCAGAAAATGGCAGG No data
1072165826_1072165830 4 Left 1072165826 10:92812239-92812261 CCTCCTTTGTCACTGGAATATCT No data
Right 1072165830 10:92812266-92812288 TGCCATTTGCAGAAAATGGCAGG No data
1072165825_1072165830 5 Left 1072165825 10:92812238-92812260 CCCTCCTTTGTCACTGGAATATC No data
Right 1072165830 10:92812266-92812288 TGCCATTTGCAGAAAATGGCAGG No data
1072165823_1072165830 17 Left 1072165823 10:92812226-92812248 CCTGGCACAGAGCCCTCCTTTGT No data
Right 1072165830 10:92812266-92812288 TGCCATTTGCAGAAAATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072165830 Original CRISPR TGCCATTTGCAGAAAATGGC AGG Intergenic
No off target data available for this crispr