ID: 1072170070

View in Genome Browser
Species Human (GRCh38)
Location 10:92849820-92849842
Sequence CCTTATTTGTAGAATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072170064_1072170070 -4 Left 1072170064 10:92849801-92849823 CCTCTCTGGATCTCGGTTTCCTT 0: 1
1: 2
2: 48
3: 423
4: 2237
Right 1072170070 10:92849820-92849842 CCTTATTTGTAGAATGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072170070 Original CRISPR CCTTATTTGTAGAATGGGGA GGG Intronic
No off target data available for this crispr