ID: 1072170585

View in Genome Browser
Species Human (GRCh38)
Location 10:92856640-92856662
Sequence TAGGATACACAGTCTTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 7, 3: 40, 4: 210}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072170585_1072170588 -9 Left 1072170585 10:92856640-92856662 CCTTGAGAAGACTGTGTATCCTA 0: 1
1: 0
2: 7
3: 40
4: 210
Right 1072170588 10:92856654-92856676 TGTATCCTACTGTTGTTGGAGGG No data
1072170585_1072170590 6 Left 1072170585 10:92856640-92856662 CCTTGAGAAGACTGTGTATCCTA 0: 1
1: 0
2: 7
3: 40
4: 210
Right 1072170590 10:92856669-92856691 TTGGAGGGAGTATTCTATAGAGG No data
1072170585_1072170587 -10 Left 1072170585 10:92856640-92856662 CCTTGAGAAGACTGTGTATCCTA 0: 1
1: 0
2: 7
3: 40
4: 210
Right 1072170587 10:92856653-92856675 GTGTATCCTACTGTTGTTGGAGG No data
1072170585_1072170591 15 Left 1072170585 10:92856640-92856662 CCTTGAGAAGACTGTGTATCCTA 0: 1
1: 0
2: 7
3: 40
4: 210
Right 1072170591 10:92856678-92856700 GTATTCTATAGAGGTCTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072170585 Original CRISPR TAGGATACACAGTCTTCTCA AGG (reversed) Intronic
901164119 1:7204607-7204629 TAGTATACACATTCTTCTTAAGG - Intronic
901222718 1:7592705-7592727 TAGGACACACAGTGTCCTCATGG + Intronic
902201836 1:14839183-14839205 TATCCTACACAGCCTTCTCATGG - Intronic
902855320 1:19199347-19199369 GGGGCTACAGAGTCTTCTCAAGG - Intronic
903304926 1:22406704-22406726 GAGGGAACACAGTCTGCTCAGGG - Intergenic
904316304 1:29667604-29667626 CAGAATACACATTCTTTTCAAGG + Intergenic
908385689 1:63639377-63639399 AAGGGTACATAGTATTCTCAGGG + Intronic
909189152 1:72530488-72530510 TAGGAGAAACAGTCTTCTGTTGG + Intergenic
909306662 1:74089103-74089125 CAGGATACAAAGTAATCTCATGG - Intronic
909368119 1:74852709-74852731 TAGAATATACAGTTTTCTTAAGG - Intergenic
909411822 1:75362745-75362767 TAGGATACATACTCTTCTCAAGG - Intronic
912277758 1:108278349-108278371 CAGAATACACATACTTCTCAAGG - Intergenic
912290468 1:108416010-108416032 CAGAATACACATACTTCTCAAGG + Intronic
913092452 1:115486936-115486958 TAAAATACACATTCTTCTCGAGG + Intergenic
913402031 1:118446987-118447009 TAGAATGCACATTCTTTTCAAGG + Intergenic
915032370 1:152893091-152893113 TAGGATACACTTTCTTTTCAAGG - Intergenic
916429763 1:164716335-164716357 TAGGCTACATATTCTTTTCAAGG - Intronic
918539709 1:185617284-185617306 TAGAATACACATTCTTCTCAAGG + Intergenic
918545039 1:185672761-185672783 TTGGTTACACAGTGTTATCAGGG - Intergenic
918802036 1:188984924-188984946 TAAAAAACACAGACTTCTCATGG - Intergenic
920120528 1:203653450-203653472 TAGGCAAAACAGTCTTCTCTTGG + Intronic
920549402 1:206845968-206845990 TAGGTTATACAGTCTTGTCCAGG - Intergenic
1063062574 10:2572194-2572216 TAGGAAACACAGCTTTCTGAAGG - Intergenic
1064867384 10:19896183-19896205 TAGGTTATACAGTCAGCTCATGG - Intronic
1065355704 10:24839076-24839098 CAGAATACACATTCTTTTCAAGG - Intergenic
1066042180 10:31560077-31560099 CAGAATACACATTCTTCTCAAGG + Intergenic
1067176370 10:43951432-43951454 CAGAATACACATTCTTCTCGAGG - Intergenic
1067297915 10:44985286-44985308 CTGGATACACAGTGTTCCCAGGG - Intronic
1067365719 10:45626651-45626673 TCGGTTACACATTCTTCTGAAGG + Exonic
1070021515 10:72590930-72590952 CAGCATACACATTCTTCTCGAGG + Intronic
1070468587 10:76752425-76752447 CAGGATGCATATTCTTCTCAAGG + Intergenic
1070489725 10:76965280-76965302 TGGGATACATAGTTTTCCCAAGG - Intronic
1070558941 10:77551296-77551318 TTGGATACACAGAATTCTCTAGG - Intronic
1071375989 10:85003848-85003870 TAGGATGAACAGTCTCTTCAAGG + Intergenic
1072170585 10:92856640-92856662 TAGGATACACAGTCTTCTCAAGG - Intronic
1072475929 10:95759690-95759712 TTGGATAAACAGTTTGCTCACGG + Intronic
1072925955 10:99617312-99617334 AAGGCTACACTGACTTCTCATGG + Intronic
1074474892 10:113762761-113762783 TAGAGTATACATTCTTCTCAAGG - Intronic
1075186698 10:120266839-120266861 TAGAATACACATTCTTGTCAAGG + Intergenic
1075516726 10:123114988-123115010 TAGGATATACTGTATTCTAAAGG + Intergenic
1081233005 11:40609108-40609130 CAGAATACACATTCTTCTCAAGG + Intronic
1081523479 11:43906145-43906167 CAGGATTCACATTCTTCACAAGG - Intronic
1084756561 11:71242769-71242791 CAGAATACTCATTCTTCTCAAGG + Intronic
1085605600 11:77895378-77895400 AAGAATACAAAGTCTACTCATGG - Intronic
1085712312 11:78841454-78841476 TAGGATTCACACTGATCTCAGGG - Intronic
1086047582 11:82550904-82550926 TAGGATTCATAGTCAGCTCAAGG - Intergenic
1086751386 11:90498471-90498493 TAGAGTATACATTCTTCTCATGG - Intergenic
1087139407 11:94750642-94750664 CAGGATACATAGGCTTCTAAAGG - Intronic
1087999594 11:104860315-104860337 TAGAATACATATTATTCTCAAGG + Intergenic
1088499979 11:110473521-110473543 TAGGCTACACAGGTTTCTGAAGG + Intergenic
1088801348 11:113310109-113310131 TGGGAAACACAGTCTACTCTAGG + Intergenic
1089685473 11:120143998-120144020 TAGGACCCAGTGTCTTCTCAGGG - Intronic
1090148998 11:124361278-124361300 CAGAATACACATTCTTCTCAAGG - Intergenic
1091972057 12:4795868-4795890 TAGGAGAGGCAGTCCTCTCAAGG + Intronic
1092575453 12:9777579-9777601 TAGGATACAAAGTGATGTCATGG + Intergenic
1093138875 12:15483756-15483778 TAGGATTAATAATCTTCTCAGGG - Intronic
1094464925 12:30742937-30742959 CAGGATACACAGTCCTCAGAGGG + Intronic
1097618288 12:61909304-61909326 TAAGGTACAGACTCTTCTCAGGG + Intronic
1099503229 12:83439541-83439563 CAGGAAACACATTCTTCTCTAGG - Intergenic
1100834841 12:98556604-98556626 CAGAATACACATTCTTCTCAAGG + Intergenic
1101167673 12:102054604-102054626 CAGAATACACATTCTTCTCAAGG + Intronic
1104731803 12:131109684-131109706 CAGAATATACATTCTTCTCAAGG - Intronic
1106538218 13:30666514-30666536 TGGGAGACTCAGTCTTCACAGGG + Intergenic
1107187605 13:37542861-37542883 CAGAATATACATTCTTCTCATGG - Intergenic
1107244178 13:38272595-38272617 CAGAATATACATTCTTCTCAGGG + Intergenic
1109346513 13:61120808-61120830 TAGCATATACATTCTTCTTAAGG + Intergenic
1115384784 14:32784420-32784442 TAGTATACACAATTTCCTCAGGG + Intronic
1115408670 14:33048250-33048272 TAGGATGACCAGTCTTCTCTGGG - Intronic
1118088760 14:62448555-62448577 TTACATACTCAGTCTTCTCAAGG + Intergenic
1118960791 14:70529222-70529244 CAGAACACACATTCTTCTCAAGG + Intronic
1121303300 14:92888970-92888992 TTGGAAACACATTCTTCTCCTGG - Intergenic
1122044145 14:99011434-99011456 AAGGATACACAGTCGGCTCCAGG + Intergenic
1122839554 14:104450387-104450409 CAGAATACACAATCTTTTCAAGG + Intergenic
1124084056 15:26530298-26530320 CAGAATATACATTCTTCTCAAGG + Intergenic
1124191419 15:27580395-27580417 TAGGATATACAGTCTTCTCTTGG + Intergenic
1126440870 15:48686888-48686910 CAGAATACACATTCTTCTCCTGG + Intergenic
1126784068 15:52162605-52162627 TAATATATACAGTCTTTTCATGG + Intronic
1126876864 15:53052325-53052347 CAGAATATACATTCTTCTCAGGG + Intergenic
1126956509 15:53938546-53938568 CAAAATACACATTCTTCTCATGG + Intergenic
1127176325 15:56362106-56362128 CAGAATACACATTTTTCTCAAGG - Intronic
1127466914 15:59252928-59252950 TAGAATCCACAGTCTCTTCAGGG - Intronic
1133543607 16:6782679-6782701 AATAATACACATTCTTCTCATGG - Intronic
1137403698 16:48173977-48173999 TAGGAGACAAACTCTTTTCAAGG - Intronic
1137475696 16:48807656-48807678 CAGAACACACATTCTTCTCAAGG + Intergenic
1140158281 16:72456420-72456442 TAGAATACACATTCTTCTCAAGG - Intergenic
1140454738 16:75098468-75098490 TAGGCTACACTCTCTGCTCAAGG + Intronic
1141474593 16:84264263-84264285 TTGCATACACAGCCTTTTCATGG - Intergenic
1145033392 17:19522538-19522560 CAGAATATACATTCTTCTCAAGG - Intronic
1145122015 17:20268785-20268807 TGGGAGACACAGTCCTCTCCTGG + Intronic
1145283204 17:21483437-21483459 TATTATACACTGTGTTCTCATGG - Intergenic
1145394279 17:22482363-22482385 TATTATACACTGTGTTCTCATGG + Intergenic
1149663724 17:58351611-58351633 TAGGATACACAGTCAACATAGGG - Intronic
1150962981 17:69935189-69935211 TAGAATAAGAAGTCTTCTCAGGG - Intergenic
1153553967 18:6291283-6291305 TTGAATACACAGTCATGTCAGGG - Intronic
1154399532 18:14023409-14023431 TTAGATCCACAGTCTCCTCATGG + Intergenic
1155742431 18:29305624-29305646 TAGGATACAAAGACTTCTTTAGG + Intergenic
1156179859 18:34590420-34590442 TAGGACAGGCAGTATTCTCATGG - Intronic
1156784830 18:40898047-40898069 TGGGAGACTCAGTCTTTTCATGG - Intergenic
1157011046 18:43649263-43649285 GAGGCAACACTGTCTTCTCAGGG - Intergenic
1157252693 18:46109571-46109593 GAGAATACACATACTTCTCAAGG - Intronic
1159509171 18:69374417-69374439 CAGAATACACATTCTTTTCATGG + Intergenic
1160482844 18:79258581-79258603 AAGGATACACAGACTTCACCTGG - Intronic
925305492 2:2845615-2845637 TAGGATCCACAGTCATCACATGG - Intergenic
925804668 2:7636400-7636422 TAGGAGGCACAGCCTTCTCTTGG - Intergenic
926680495 2:15659738-15659760 TAGGATACCTAGACTTCCCATGG - Intergenic
926759436 2:16264824-16264846 TAGGATTCAGAGCCTTCTCACGG - Intergenic
926824354 2:16888373-16888395 CAGAATACACACTCTTCTCTGGG - Intergenic
927923547 2:26992798-26992820 TGGCCTACACAGTCTTCACAAGG - Intronic
928849816 2:35731999-35732021 TTGGATACTCTGTTTTCTCATGG - Intergenic
929626334 2:43412104-43412126 TAGCATTCAAAGTCTTCACAGGG + Intronic
931955194 2:67416324-67416346 CAGAATACACATTCTTCTCATGG + Intergenic
932626505 2:73300687-73300709 TAGAACACACAGTCTGCTAAAGG - Intergenic
933054516 2:77645020-77645042 CAGAATACACATTCTTCTCAAGG - Intergenic
933109394 2:78378739-78378761 TAGGATACAAAATATTCACAAGG + Intergenic
935149848 2:100424071-100424093 TAGGATATACATTCTTCTCAAGG + Intergenic
937055370 2:118930498-118930520 TACAATACACATTCTTCTCAAGG - Intergenic
937376753 2:121341807-121341829 CAGAACACACATTCTTCTCAAGG + Intronic
938508359 2:131911362-131911384 AAGGACACACAGTCCTGTCATGG - Intergenic
939028780 2:137045781-137045803 TGGGGTACCCAGTCTTCTCAAGG - Intronic
940722504 2:157297730-157297752 TAGGGTATACAGTGATCTCAAGG - Intronic
941590762 2:167417319-167417341 TAGCATACTCAGTTTTCTTATGG + Intergenic
942436375 2:175981759-175981781 TAGGGGCCACAGTCATCTCAAGG - Intronic
942492229 2:176500892-176500914 AAGGATACACTGTCTTTTGATGG - Intergenic
943087959 2:183336611-183336633 CAGAAGACACATTCTTCTCAAGG - Intergenic
943346632 2:186745469-186745491 GAGGACTCACAGTGTTCTCACGG - Intronic
943919197 2:193680582-193680604 AAGGATACACATTCTTCTCAAGG - Intergenic
944093799 2:195944154-195944176 TAGGAAAGAAATTCTTCTCATGG - Intronic
945646736 2:212505511-212505533 TGGGAAACACAGTCTTCCAAAGG + Intronic
946562889 2:220932616-220932638 TAGGATACAAATTCTTTACAAGG + Intergenic
947501860 2:230676735-230676757 TAGGAACCACAGTTTACTCAGGG + Intergenic
948325869 2:237120266-237120288 TAAGATACACAGTATCCACAAGG - Intergenic
948817101 2:240517372-240517394 TGGGAGAACCAGTCTTCTCAAGG - Intronic
1169512696 20:6281730-6281752 TAGAAAACACAATATTCTCAAGG - Intergenic
1175654621 20:60759207-60759229 GTGGATATACAGTTTTCTCAAGG - Intergenic
1176881401 21:14198797-14198819 TAGAATACACATTTTTTTCAAGG + Intronic
1178372829 21:32040998-32041020 CAGAATATACATTCTTCTCAGGG + Intronic
1182886227 22:33776454-33776476 GAGGATATACATTCTTCCCAAGG + Intronic
1182962917 22:34493057-34493079 AAGGATAAACAGTCTTCCAAGGG + Intergenic
949184632 3:1175433-1175455 GAGAAAACACAGTCTACTCAAGG + Intronic
949725361 3:7038348-7038370 TAGGATACCAAGTATTTTCAGGG - Intronic
955128945 3:56144359-56144381 TATGATCAACACTCTTCTCAGGG + Intronic
955148729 3:56345875-56345897 GAAGTAACACAGTCTTCTCAGGG - Intronic
955458104 3:59147375-59147397 TAGAATACATATTCTTCTCAAGG - Intergenic
956308008 3:67847805-67847827 TAGGGGACAGAGTCTCCTCAGGG - Intergenic
956633625 3:71341171-71341193 CAGAATATACACTCTTCTCAAGG + Intronic
956688986 3:71858705-71858727 AAGGAGAGACAGTCTGCTCAGGG + Intergenic
957699919 3:83695775-83695797 CACAATACACATTCTTCTCAAGG + Intergenic
957877355 3:86165014-86165036 TAGGAGGCACAGTTATCTCAAGG + Intergenic
961495102 3:127285581-127285603 TAGGCTACACAGGTTTCCCAGGG - Intergenic
962449083 3:135496729-135496751 TCTGTTACACAATCTTCTCAAGG - Intergenic
962626416 3:137229925-137229947 TAGGATTCACAGGTTCCTCATGG - Intergenic
964190532 3:153995340-153995362 TAAGAAACACACTTTTCTCAGGG - Intergenic
965148528 3:164939048-164939070 TGAGCTACACCGTCTTCTCAGGG - Intergenic
965678492 3:171225211-171225233 TAGAATAGACTGTCTTCTAAAGG + Intronic
966355654 3:179075912-179075934 CAGAATACACATTCTTCTCAAGG - Intergenic
966488653 3:180501215-180501237 CAGAATATACATTCTTCTCATGG - Intergenic
967872199 3:194239843-194239865 CAGAATACACATTCTTCTCAAGG + Intergenic
970814870 4:20143087-20143109 CAGAATATACATTCTTCTCAGGG + Intergenic
970906145 4:21218682-21218704 AAGGATTCACAGACATCTCAAGG + Intronic
971663462 4:29451075-29451097 AAGAATATACATTCTTCTCAGGG - Intergenic
972345357 4:38188360-38188382 CAGGCTCCACAGTCTTCCCAGGG - Intergenic
974632097 4:64506333-64506355 AAGAATACACACTCTTCTCAAGG + Intergenic
974965326 4:68753323-68753345 CAGAATATACATTCTTCTCATGG + Intergenic
975320593 4:73005939-73005961 TGGGGTACACACACTTCTCAAGG + Intergenic
976222178 4:82765386-82765408 TAGTATACATAGTCTTCCCTTGG + Intronic
978977865 4:114901096-114901118 CATAATACACCGTCTTCTCAAGG - Intronic
979179773 4:117710366-117710388 TAGAATATACATTCTTCTCATGG + Intergenic
980177565 4:129365248-129365270 CAGGATGCGCAGGCTTCTCATGG - Intergenic
981850270 4:149221076-149221098 CAGAATATACATTCTTCTCATGG + Intergenic
983372890 4:166885503-166885525 TAGGATACAGAGTACTTTCAAGG - Intronic
983823285 4:172224719-172224741 TGTGATACACAGTCTTCACAGGG - Intronic
984076697 4:175190597-175190619 CAGAATACACATTCTTCTCAAGG - Intergenic
984511244 4:180681473-180681495 AAGGATACAATGACTTCTCAAGG + Intergenic
985001454 4:185488029-185488051 CAGAAAACACATTCTTCTCAAGG - Intergenic
985299805 4:188475981-188476003 TAGGAGACACAGCATTCTTATGG - Intergenic
987887913 5:23834466-23834488 CAGCATATACATTCTTCTCATGG + Intergenic
988493419 5:31724629-31724651 TGGGTTACACAGTATTTTCAGGG - Intronic
990141728 5:52712443-52712465 TAGGAAATAATGTCTTCTCATGG + Intergenic
991211639 5:64111857-64111879 CAGAATATACATTCTTCTCATGG + Intergenic
993173833 5:84456064-84456086 CAGAATACACATTCTTTTCAAGG + Intergenic
993940179 5:94048699-94048721 TAGGAAACCCAATCTTCTAAAGG + Intronic
994009418 5:94883285-94883307 TTGGATAAAATGTCTTCTCATGG + Intronic
994945621 5:106385157-106385179 TATAATACAGTGTCTTCTCAAGG - Intergenic
995593797 5:113727691-113727713 CAGAATATACATTCTTCTCAGGG - Intergenic
996068463 5:119106984-119107006 TATGATATACAAGCTTCTCAAGG - Intronic
996632323 5:125648680-125648702 TAGGATAAACTTTCTTCTCAGGG + Intergenic
997335044 5:133101728-133101750 AAGAATACACAGTCTTCATACGG - Intronic
999236032 5:150095319-150095341 CAGAATACACATTCATCTCAAGG + Intronic
999552355 5:152703171-152703193 TGGGATACACTCTATTCTCAAGG + Intergenic
999690411 5:154141327-154141349 AAGGTCACACAGTCTTCTTAGGG + Intronic
999710803 5:154316622-154316644 TGGGATACACAGTCTAATCAGGG - Intronic
1000460933 5:161517288-161517310 TAGGATATACGGGCTTCTCAGGG + Intronic
1002646789 5:180661497-180661519 CAGAATATACATTCTTCTCAGGG - Intergenic
1003055660 6:2817421-2817443 CAGAATACACATTTTTCTCAAGG - Intergenic
1003686827 6:8312755-8312777 CAGAATATACATTCTTCTCAGGG - Intergenic
1006806371 6:36792223-36792245 CAGGAGACTCTGTCTTCTCAGGG - Intronic
1007458595 6:42000072-42000094 GAGAATACACATTCTTTTCAAGG + Intronic
1007506273 6:42337672-42337694 AAGGACACACAGCCTTCTAATGG + Intronic
1009840035 6:69058896-69058918 CAGAATACACATTCTTCTCAAGG - Intronic
1010133057 6:72518096-72518118 TATGATCCAGAGCCTTCTCAGGG - Intergenic
1010370450 6:75101029-75101051 CAGGAAACCCAGTCTTCTCTAGG - Intronic
1011525169 6:88256293-88256315 CAGAATATACATTCTTCTCAGGG + Intergenic
1016676849 6:146780883-146780905 CAGAATACACATTCTTCTCAAGG + Intronic
1018806107 6:167261286-167261308 CAGAATATACATTCTTCTCAGGG + Intergenic
1025036583 7:55597046-55597068 GGGGATTCACAGTCTTCACAGGG + Intergenic
1025897250 7:65714597-65714619 AAGAATACAAAGTCTACTCATGG + Intergenic
1028942336 7:96536367-96536389 CAGAATACACATTCTTCTCAAGG - Intronic
1029009372 7:97242531-97242553 CAGAATACACATTTTTCTCAAGG + Intergenic
1029051913 7:97698948-97698970 CAGAATACACATTCTTCTCAAGG + Intergenic
1031150496 7:118048552-118048574 TAGTATAGACAGTTTTTTCAAGG - Intergenic
1031804841 7:126295038-126295060 CAGGATATACATTGTTCTCAAGG + Intergenic
1033540767 7:142353657-142353679 TGGGACACACAGTCTTCTTTGGG + Intergenic
1034297641 7:149988484-149988506 ATGGATACACAGTCATCTCAGGG - Intergenic
1034808381 7:154108369-154108391 ATGGATACACAGTCATCTCAGGG + Intronic
1036285291 8:7439368-7439390 AAGAATACACGTTCTTCTCAAGG - Intergenic
1036336185 8:7872161-7872183 AAGAATACACGTTCTTCTCAAGG + Intergenic
1037057777 8:14465030-14465052 CAGAATACATATTCTTCTCAAGG - Intronic
1037345096 8:17890437-17890459 TGAAATACACAGACTTCTCAGGG + Intronic
1040074578 8:43216147-43216169 TAGCACACACAGTCTTTCCATGG + Intergenic
1040112815 8:43578197-43578219 GGGGATACTCAGTCTTTTCACGG - Intergenic
1042632937 8:70840677-70840699 GAGGATGCACAGGCCTCTCAGGG - Intergenic
1043682854 8:83052570-83052592 TTGGAGTTACAGTCTTCTCAGGG - Intergenic
1044389095 8:91627757-91627779 TAGGATGCTCAGTCTTATGATGG + Intergenic
1044612184 8:94103189-94103211 TAGGATACACATTATTTTCAAGG - Intergenic
1046249982 8:111617240-111617262 TCTGAGACACACTCTTCTCATGG + Intergenic
1046810707 8:118530264-118530286 TGTGACACACAGTCTACTCATGG - Intronic
1047217654 8:122889881-122889903 GAGGAAATACAGTCCTCTCATGG - Intronic
1047601548 8:126430571-126430593 TTGGAGACACAGTCTGATCAAGG - Intergenic
1048720379 8:137317489-137317511 TGGAATACACATTCTTTTCAAGG - Intergenic
1048736832 8:137511380-137511402 TAGTAGTCATAGTCTTCTCAGGG + Intergenic
1049703953 8:144029755-144029777 TAGAATATACATTATTCTCAAGG - Intronic
1053530118 9:38872756-38872778 CAGAATACACATTCTTTTCAAGG + Intergenic
1053571594 9:39315383-39315405 CAGAATACACATTCTTCTCAGGG - Intergenic
1053837502 9:42156728-42156750 CAGAATACACATTCTTCTCAGGG - Intergenic
1054093151 9:60874085-60874107 CAGAATACACATTCTTCTCAGGG - Intergenic
1054114629 9:61149997-61150019 CAGAATACACATTCTTCTCAGGG - Intergenic
1054125551 9:61303629-61303651 CAGAATACACATTCTTCTCAGGG + Intergenic
1054202343 9:62097183-62097205 CAGAATACACATTCTTTTCAAGG + Intergenic
1054593125 9:67032530-67032552 CAGAATACACATTCTTCTCAGGG + Intergenic
1054636015 9:67491177-67491199 CAGAATACACATTCTTTTCAAGG - Intergenic
1055888622 9:81097798-81097820 TAGGATACACATTTTTACCATGG - Intergenic
1058776716 9:108291383-108291405 TGGGAAATACAGTTTTCTCAAGG + Intergenic
1059381010 9:113924974-113924996 CACAATACACATTCTTCTCAAGG - Intronic
1059500849 9:114752744-114752766 GAGGATACAAAGTATTCTGAAGG - Intergenic
1059891817 9:118812426-118812448 TAGGATACACGGCCTTCTCAGGG + Intergenic
1061214614 9:129214084-129214106 TTTGTTACACAGTCTTATCATGG + Intergenic
1187856255 X:23638358-23638380 AAGAATACACATTCTTCTCAAGG + Intergenic
1188590327 X:31825524-31825546 TAGGTTCCACTCTCTTCTCATGG + Intronic
1190591335 X:52005327-52005349 TAGAATACATATTTTTCTCAAGG - Intergenic
1193417819 X:81245314-81245336 TAGGTAACAGAGTCTCCTCAAGG - Intronic
1193687006 X:84589617-84589639 CAGAATACACATTCTTCTCATGG + Intergenic
1197150935 X:123219218-123219240 TAAAATACACAGCCTTCTTAGGG - Intronic
1197293769 X:124692127-124692149 GAGAATACACCTTCTTCTCAAGG - Intronic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1199561164 X:149163899-149163921 CAGAATATACATTCTTCTCATGG + Intergenic
1201055102 Y:9980768-9980790 TAGGATAAACAGACTTATCTAGG - Intergenic
1201345375 Y:12977712-12977734 TAGAAAACACAATCTCCTCAAGG + Intergenic
1202072028 Y:21001939-21001961 TATGTTACACACTCTTTTCAAGG + Intergenic