ID: 1072171074

View in Genome Browser
Species Human (GRCh38)
Location 10:92862339-92862361
Sequence AGGTTTTAACATATGAATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4330
Summary {0: 1, 1: 27, 2: 259, 3: 1012, 4: 3031}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072171074_1072171082 26 Left 1072171074 10:92862339-92862361 CCATAATTCATATGTTAAAACCT 0: 1
1: 27
2: 259
3: 1012
4: 3031
Right 1072171082 10:92862388-92862410 AGGTCATTTGGGTGGTAGTTAGG No data
1072171074_1072171078 6 Left 1072171074 10:92862339-92862361 CCATAATTCATATGTTAAAACCT 0: 1
1: 27
2: 259
3: 1012
4: 3031
Right 1072171078 10:92862368-92862390 CCAATGTGATAGTTTGAGGTAGG No data
1072171074_1072171076 2 Left 1072171074 10:92862339-92862361 CCATAATTCATATGTTAAAACCT 0: 1
1: 27
2: 259
3: 1012
4: 3031
Right 1072171076 10:92862364-92862386 ATCACCAATGTGATAGTTTGAGG No data
1072171074_1072171081 18 Left 1072171074 10:92862339-92862361 CCATAATTCATATGTTAAAACCT 0: 1
1: 27
2: 259
3: 1012
4: 3031
Right 1072171081 10:92862380-92862402 TTTGAGGTAGGTCATTTGGGTGG No data
1072171074_1072171080 15 Left 1072171074 10:92862339-92862361 CCATAATTCATATGTTAAAACCT 0: 1
1: 27
2: 259
3: 1012
4: 3031
Right 1072171080 10:92862377-92862399 TAGTTTGAGGTAGGTCATTTGGG No data
1072171074_1072171079 14 Left 1072171074 10:92862339-92862361 CCATAATTCATATGTTAAAACCT 0: 1
1: 27
2: 259
3: 1012
4: 3031
Right 1072171079 10:92862376-92862398 ATAGTTTGAGGTAGGTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072171074 Original CRISPR AGGTTTTAACATATGAATTA TGG (reversed) Intronic
Too many off-targets to display for this crispr