ID: 1072181842

View in Genome Browser
Species Human (GRCh38)
Location 10:92991135-92991157
Sequence TTTTTTCCCAAGACAGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072181841_1072181842 5 Left 1072181841 10:92991107-92991129 CCATTAGTGATTCTGGCAACTTT 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1072181842 10:92991135-92991157 TTTTTTCCCAAGACAGAGTCTGG No data
1072181839_1072181842 23 Left 1072181839 10:92991089-92991111 CCACTTCTGTTGTCTAAACCATT 0: 1
1: 0
2: 1
3: 21
4: 210
Right 1072181842 10:92991135-92991157 TTTTTTCCCAAGACAGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072181842 Original CRISPR TTTTTTCCCAAGACAGAGTC TGG Intronic
No off target data available for this crispr