ID: 1072185909

View in Genome Browser
Species Human (GRCh38)
Location 10:93038801-93038823
Sequence TTTGAGTTCTTCAAGGGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072185909_1072185912 11 Left 1072185909 10:93038801-93038823 CCTCTACCCTTGAAGAACTCAAA 0: 1
1: 0
2: 2
3: 27
4: 223
Right 1072185912 10:93038835-93038857 AAGTGAAAACAAACATACAAAGG 0: 1
1: 0
2: 8
3: 88
4: 941

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072185909 Original CRISPR TTTGAGTTCTTCAAGGGTAG AGG (reversed) Intronic
902437052 1:16405068-16405090 TTTGAGATCTTCAATGGTCCTGG - Exonic
904300780 1:29552034-29552056 TGTGAGTTCCTTGAGGGTAGAGG - Intergenic
904414942 1:30354765-30354787 TGTGAGTTCTACAAGGGTAGGGG + Intergenic
904457424 1:30656009-30656031 TGTGAGTTCCTTGAGGGTAGGGG + Intergenic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
905342380 1:37288103-37288125 TATGAGTTATTTGAGGGTAGTGG - Intergenic
906300734 1:44679903-44679925 TGTGAGTTCCTCAAGGGCAGGGG - Intronic
907619346 1:55960417-55960439 TTTGTGTTCTTCAAGGGGAATGG + Intergenic
909139578 1:71846542-71846564 TCTGGGTTCTTCAAGGGTATGGG - Intronic
909414541 1:75390372-75390394 TCTAAGTTCATCAAGGGTATTGG - Intronic
909970835 1:81986791-81986813 TTTATATTCATCAAGGGTAGTGG - Intronic
912950526 1:114117491-114117513 TTGGAGTTGTTCCTGGGTAGAGG + Intronic
913277786 1:117155977-117155999 TATGAGCTCTGTAAGGGTAGGGG + Intronic
913549998 1:119907853-119907875 TTTAAGGTCCTCAAGGGTCGAGG + Intergenic
915594746 1:156890029-156890051 TCTGAGTTCTTCAAGGACTGAGG - Intergenic
915616582 1:157044016-157044038 TTTGACTTTTGCCAGGGTAGAGG - Intronic
919181304 1:194085667-194085689 TGTGAGTTCTTTGAGGGCAGAGG + Intergenic
919714357 1:200760043-200760065 TTGGCATTCTTAAAGGGTAGTGG + Intronic
920577667 1:207073425-207073447 TTTGAGTTGCTCAAGGCAAGAGG + Exonic
920783910 1:209021919-209021941 TGTGAGTTCCACAAGGGCAGGGG - Intergenic
921034768 1:211366455-211366477 TGTTAGTTCTTCAAGGGTAGAGG - Intronic
921200862 1:212804737-212804759 TCTGATTTCTTGAAGGGCAGGGG + Intronic
921212125 1:212909905-212909927 AGTGAGTTATTCATGGGTAGTGG - Intergenic
922991794 1:229920586-229920608 ATTGAGTTTCTCAAGGGCAGAGG - Intergenic
924250612 1:242129363-242129385 CTTGAGTCATTCTAGGGTAGAGG - Intronic
924330519 1:242936415-242936437 ATTGAGCTCCTCAAGGGCAGAGG + Intergenic
1064456651 10:15493274-15493296 TTTGAGTTCTTCAAGAGTCTTGG - Intergenic
1065815090 10:29475898-29475920 TTTAAGTTCTTAAAAGGTAGGGG + Intronic
1066821547 10:39498212-39498234 TTTGAGGCCTTCAATGGAAGTGG + Intergenic
1067524720 10:47031374-47031396 TTTGAGTTCTTGAAATGTAGGGG + Intergenic
1068824157 10:61414466-61414488 TTTAAATGCTTCAAGTGTAGAGG + Intronic
1070480839 10:76881363-76881385 TGTAAGTGCTTCAAGGGTACTGG - Intronic
1071712888 10:88067045-88067067 TTTGAGCGCTTCATGTGTAGCGG + Intergenic
1071800600 10:89055706-89055728 TGTGAGATCCTCAAGGGAAGTGG + Intergenic
1072185909 10:93038801-93038823 TTTGAGTTCTTCAAGGGTAGAGG - Intronic
1074046129 10:109840991-109841013 TTTGAGCTCTCCAAGGGCAGGGG + Intergenic
1074905379 10:117858146-117858168 TTTGAATTGTTGAAGAGTAGAGG - Intergenic
1076184177 10:128433754-128433776 TTTGAGGTCTTGCAGGATAGAGG + Intergenic
1076225269 10:128769642-128769664 CTTGTGCTCTTCAAGGGCAGAGG - Intergenic
1076367917 10:129934225-129934247 TCTGGGGTCTTCAAGGGTGGAGG - Intronic
1078049477 11:7949526-7949548 TGTGAGTCCCTCAAGGGCAGGGG + Intergenic
1079455467 11:20632497-20632519 TTTGATTTGAACAAGGGTAGGGG + Intronic
1079652483 11:22947181-22947203 TATGAGTTCTGGAAGGGGAGGGG - Intergenic
1080440007 11:32284341-32284363 TCTGTGTTCTTCAAGGATATTGG - Intergenic
1080706201 11:34696756-34696778 TTTGATTTCTTTATGTGTAGTGG + Intergenic
1081925948 11:46828474-46828496 TGTGAGTTCCTCAAGGGCAAGGG + Intronic
1082985247 11:59163362-59163384 TTTGATATCTTCAAGGGCTGTGG - Intergenic
1085753058 11:79178694-79178716 CTGGAGTTCCTCAAGGGCAGAGG + Intronic
1085802151 11:79600621-79600643 TGTGAGCTCTTCCAGGGTAGGGG + Intergenic
1087287730 11:96283522-96283544 TTTTAGTTCTTCAAGGCAAAAGG - Intronic
1088651948 11:111965458-111965480 TTTGAGTTCTTGAGGGATATAGG + Intronic
1090027570 11:123180845-123180867 TTTGGCATCTTCAAGGGCAGAGG + Intronic
1090791722 11:130095941-130095963 TGTGACTTCGTCAAGGGGAGAGG - Intronic
1091238679 11:134038179-134038201 TGTAAGTTCCTCAAGGATAGGGG + Intergenic
1091408211 12:221863-221885 TATGAGTACCTCAAGGGTACAGG + Intronic
1093592540 12:20920594-20920616 TCTCAGTTCATCAAGGGTATTGG + Intergenic
1096504535 12:52084430-52084452 TGTGAGCTCTTCAGGGGCAGGGG - Intergenic
1096848651 12:54421342-54421364 TTTGAGTTGGCCAAGGCTAGGGG - Intergenic
1098415155 12:70225728-70225750 TTTGAGTTTTACAAGTATAGTGG + Intergenic
1099695123 12:86009673-86009695 TTTTAGTTGTTTAAGGATAGAGG + Intronic
1100775977 12:97975062-97975084 CTTGAGTGGCTCAAGGGTAGCGG + Intergenic
1100968371 12:100039001-100039023 TTTGAGTTCTTCAATAGTCACGG + Intronic
1101059721 12:100958465-100958487 TGTGAGTTTCACAAGGGTAGGGG - Intronic
1103835209 12:123813782-123813804 CTTGAGATCTTCAAGGGTATTGG - Exonic
1104171933 12:126290848-126290870 GTGGAGTTCTTCAAGGGAAGAGG - Intergenic
1104209869 12:126678337-126678359 TCTGAGTTCTGCACGGCTAGGGG - Intergenic
1107825441 13:44324995-44325017 TCTGAGTTCTTCAGGGTTAGAGG - Intergenic
1111324284 13:86671544-86671566 TTTGAGTTTTTAAAGAGTAATGG - Intergenic
1113360318 13:109624931-109624953 TGTGAGTTCTTCAATGGCAGGGG - Intergenic
1114502413 14:23180790-23180812 GTTCAGGTATTCAAGGGTAGAGG - Intronic
1114691869 14:24590635-24590657 TCTAAGTTCATCAAGGGTATTGG + Intergenic
1117467868 14:56011875-56011897 GGTGAGTTCTTAAAGGGCAGGGG + Intergenic
1119604730 14:76005415-76005437 TTTGAGTTCCACAAAGTTAGAGG - Intronic
1120023538 14:79556507-79556529 GTTGAGTTAGTCAAGGGGAGTGG - Intronic
1120260710 14:82181396-82181418 TTTGAGTTCTTCAAGGATTTTGG - Intergenic
1121872068 14:97417457-97417479 TTCTATTTCTTCAAGGGGAGAGG - Intergenic
1127223692 15:56908365-56908387 CAGGAGTTCTTCAAGGGTAAAGG - Intronic
1127763098 15:62159979-62160001 TTTGTGTTCTTCAGGGATATTGG - Intergenic
1131352293 15:91712424-91712446 TTTGAGTTCTGCATGAGTAAAGG - Intergenic
1131743140 15:95416268-95416290 TTTGAGCTCTTCAGGGAAAGAGG + Intergenic
1131946252 15:97625344-97625366 TTTGAGTTCTTCTAAGTTAATGG + Intergenic
1135287957 16:21210308-21210330 TGTGAGCTCTCCCAGGGTAGGGG - Intronic
1135892061 16:26366160-26366182 TGTGTGCTCTTCAAGGGCAGTGG - Intergenic
1144784034 17:17822072-17822094 TTTGAGGTAGTCTAGGGTAGTGG - Intronic
1146244367 17:31266433-31266455 TTAGAGTTGTTAAAGGGCAGGGG - Intronic
1146811787 17:35909705-35909727 TTTGAGTTCTCCATGGTTGGAGG + Intergenic
1147232770 17:39031125-39031147 GTTGAGTTCTTCATGGTTGGAGG - Intergenic
1149591759 17:57835149-57835171 AATGAGCTCTCCAAGGGTAGTGG - Exonic
1150880545 17:69020953-69020975 TTTATGTTCTTGAAGGGTAGAGG - Intronic
1150955473 17:69854608-69854630 TTTGAGTTTTTCCAGGACAGAGG - Intergenic
1151069925 17:71197438-71197460 TCTGTGTTCTTCAAGAGTATTGG - Intergenic
1154442610 18:14405920-14405942 TTCGCTTTCTTCAAGGATAGTGG + Intergenic
1155037035 18:22033434-22033456 TTTCAGTTCTCAAAGGGTGGTGG - Intergenic
1155702785 18:28768700-28768722 TTTGAGTTCTTGGAGGGGATGGG - Intergenic
1157162461 18:45326557-45326579 TTTGAGTTCCAGGAGGGTAGGGG - Intronic
1158501606 18:58007395-58007417 TGTAAGTTCTTTAAGGGAAGAGG + Intergenic
1159090379 18:63841786-63841808 TCTAAGTTCTCCAAGGGCAGGGG - Intergenic
1160049575 18:75420258-75420280 CTTGAATTCTTCAAGGCTAGAGG - Intronic
1160177046 18:76603456-76603478 TTTGAGGACTTCAAAGGTGGTGG + Intergenic
1161949218 19:7458497-7458519 TTTGAGTCCTGCATGAGTAGAGG - Exonic
1162589866 19:11584392-11584414 TTTTAATTTTTAAAGGGTAGGGG - Intronic
1164147341 19:22520038-22520060 TCTAATTTCTTCAAGGGGAGGGG - Intronic
1164159257 19:22616072-22616094 TCTAATTTCTTCAAGGGGAGGGG + Intergenic
1164614755 19:29660344-29660366 TGTGAGCTCCCCAAGGGTAGAGG + Intergenic
1164661313 19:29972600-29972622 TTAGAGTTCTTTAAGGATAAGGG + Intronic
1164945881 19:32292656-32292678 GTTGAGTTCTGCAAGGGTTAGGG - Intergenic
1165316117 19:35056332-35056354 TTTGAGTTCCACAGGGGTCGGGG + Intronic
1165981929 19:39731770-39731792 TTGGAGATCTTCCAGGATAGAGG - Intronic
1166936685 19:46337893-46337915 TATGAGACCTTCAAGGGCAGGGG + Intronic
1168469966 19:56631724-56631746 TTTTAGATCTTCAAGGGTCCAGG + Intergenic
930262562 2:49164658-49164680 TTTGAGTTTTCCAAGGGAAGGGG - Intergenic
931357876 2:61553075-61553097 TATGAGTTCTTGGAGGGCAGGGG - Intergenic
932186384 2:69699794-69699816 TTTGAGGCTTTCAAGGGAAGAGG + Intronic
932763296 2:74454723-74454745 TGTGAGTTCCTCAAGGACAGGGG + Intergenic
935344960 2:102099351-102099373 TTTGAGTTCTTCCAGGGATGGGG + Intronic
935431166 2:102977442-102977464 TGTGAGTTCATCAAGGATTGAGG - Intergenic
936995988 2:118414830-118414852 TTTGAGTTCTTCAAAGATTCTGG - Intergenic
939557453 2:143692967-143692989 TTGGACTTCTTCAAAGGAAGAGG + Intronic
939894292 2:147773131-147773153 TTTGAGTTCTTCAAGAGGTATGG - Intergenic
940043338 2:149384023-149384045 TGTGAGCTGCTCAAGGGTAGAGG + Intronic
941592110 2:167432660-167432682 TTTGAGTTTTTCAAAGGTGGAGG - Intergenic
941721996 2:168822053-168822075 TCTGAGTTCATCAAGGGTGATGG + Intronic
942089298 2:172473115-172473137 TTTGAGAACTGCAACGGTAGTGG + Intronic
943469931 2:188281960-188281982 TGTGAGCTCCTTAAGGGTAGAGG + Intergenic
943841044 2:192581124-192581146 TTTGATTACTACAAAGGTAGTGG + Intergenic
945464231 2:210148234-210148256 TTTTAATTCTCCAAGGGTTGTGG - Intronic
946012316 2:216575325-216575347 AGTGAGTTCTTTGAGGGTAGGGG + Intronic
948258502 2:236585464-236585486 TTTTAGTCCTTCAGGGGCAGTGG + Intergenic
1168791046 20:576045-576067 TTTAAGTCCTGGAAGGGTAGAGG + Intergenic
1169616361 20:7450695-7450717 TTTGAGGGCTTCAAGACTAGTGG + Intergenic
1169678339 20:8180380-8180402 TCTGAGTTCATCAAGGATATTGG + Intronic
1170871568 20:20211167-20211189 TTTGAGTTCATCAGAGGCAGAGG + Intronic
1171807696 20:29698404-29698426 TTTGAGTCCTTCGAGGGAAATGG - Intergenic
1173260074 20:41426257-41426279 TCTGAGTTGTTCATGGGCAGGGG - Intronic
1174750731 20:53108957-53108979 CCTGAGTTCTTGGAGGGTAGAGG - Intronic
1175353147 20:58340643-58340665 TTTAAGTTCTTTGAGTGTAGGGG - Intronic
1176604510 21:8818194-8818216 TCTGAGTTCATCAAGGATATTGG + Intergenic
1177784515 21:25656465-25656487 TTTGGGGTCTTCAAGGCTAAAGG - Intronic
1180346801 22:11709802-11709824 TCTGAGTTCATCAAGGATATTGG + Intergenic
1181257510 22:21573445-21573467 GTTGAGCTCCTCAAGGGCAGAGG - Intronic
1181913352 22:26258163-26258185 TTTGTGTATTTCAAAGGTAGAGG - Intronic
1183056636 22:35310795-35310817 TGTGAGCTCTTTAAGGGTGGCGG - Intronic
949798928 3:7881784-7881806 TTTGTGTTCATCAAGGATATTGG - Intergenic
950783623 3:15413828-15413850 TGTGAGCTCTTCAAGGGCAGGGG + Intronic
951198455 3:19851098-19851120 TTTAAGTTCATCAAGGATATTGG - Intergenic
951296945 3:20949055-20949077 ATGGTGTTCTTCAAGGATAGTGG + Intergenic
952079792 3:29744193-29744215 TTCCTGTTCCTCAAGGGTAGAGG + Intronic
954574642 3:51669176-51669198 TTTAATTTCTTCAAGGGGAGGGG + Intronic
959606195 3:108244379-108244401 TTTGAATTCTTCAAGTCTATAGG - Intergenic
960818597 3:121701786-121701808 TATAAGCTCTTCAAGGGCAGGGG - Intronic
962270796 3:133976736-133976758 TTTGAGATGTTGAAGGGCAGGGG - Intronic
963739528 3:149062699-149062721 TTTCAGTTCTTCACATGTAGTGG - Intronic
965697289 3:171422690-171422712 TATGAGCTCTTCAAGGGTCAAGG - Intronic
965767116 3:172142647-172142669 ATTAAGTTCTTCAAGGGCAAGGG + Intronic
966130691 3:176634882-176634904 TTTGAGTTAGTAGAGGGTAGTGG - Intergenic
966212171 3:177464621-177464643 TTTGAGTTTCTCTAGGGCAGGGG + Intergenic
971263811 4:25080598-25080620 ATTCAGTTCTTCAAGAGCAGGGG + Intergenic
972145234 4:36015940-36015962 TTAGAGTTCTTCCATGGAAGCGG - Intronic
972685091 4:41344882-41344904 TTTTACTTCTTCATGGGTGGTGG - Intergenic
972747398 4:41950444-41950466 TTGGATTTCTTCATTGGTAGAGG + Intronic
974454771 4:62114297-62114319 TTTGATTTTTTTAAGGGTGGGGG + Intergenic
981627322 4:146773664-146773686 TTTATGTTCTTCAAGGATATTGG + Intronic
982066039 4:151655338-151655360 TTTGAGTTCATTGAGGGCAGGGG - Intronic
982397614 4:154929231-154929253 TTTGAGTTCTCCAATGGTGAAGG - Intergenic
982591173 4:157313536-157313558 TTTAAGGTCTTTCAGGGTAGGGG + Intronic
983106743 4:163695816-163695838 TTTTATTTCTTCTAGGGTAAAGG - Intronic
983516735 4:168665284-168665306 TGTAAGTTTTTCCAGGGTAGAGG + Intronic
984266362 4:177501861-177501883 TTTGTGTTCATCAAGGATATTGG + Intergenic
984723072 4:182994582-182994604 TTTGAGTTCCTCTAGTGCAGGGG - Intergenic
986806778 5:11314780-11314802 ATTCATTTCTTCAGGGGTAGTGG - Intronic
987023822 5:13902710-13902732 TTTCAGTTCCTCTAGGGCAGGGG - Intronic
987128986 5:14843003-14843025 TTTGAGAGCTTCAAGGTAAGAGG + Intronic
987548300 5:19342829-19342851 TTTAAGATCTTTAATGGTAGTGG + Intergenic
987912248 5:24162973-24162995 TTAGTGTTCTTCAAGATTAGAGG + Intronic
989183674 5:38602611-38602633 TCTGAGTTCTTCAAGGACAGGGG + Intronic
989585033 5:43067802-43067824 TTTGAGGATTTCAAGGGGAGAGG - Intronic
989828584 5:45888964-45888986 TTTGAGTTTTGAAAGGATAGAGG - Intergenic
990354755 5:54955481-54955503 TTTGACTTCTGCAAGGATAAGGG - Intergenic
991956702 5:72001906-72001928 TTTGAGTTCCTTGAAGGTAGAGG + Intergenic
994104967 5:95937308-95937330 TCTGAGCTCTTCAAGGGCAAGGG + Intronic
994670755 5:102758812-102758834 TTTTAGTTTCTCCAGGGTAGGGG + Intronic
995869191 5:116726279-116726301 TTTGTTTTGTACAAGGGTAGGGG - Intergenic
998370791 5:141659720-141659742 TCTGGGTCCTGCAAGGGTAGGGG + Intronic
999398052 5:151243200-151243222 GGTGAGTTCTTCAAGGACAGAGG + Intronic
999635370 5:153616359-153616381 TTTGAGTTCCTCTAGGACAGGGG + Intronic
999718314 5:154379809-154379831 TTTGAGTTCCTCAAGACTGGAGG - Intronic
999971315 5:156866706-156866728 TTTAAGTTCTTGAAGGGAAAAGG + Intergenic
1000726985 5:164783725-164783747 TTTGAGTTCATCGAGGATATTGG + Intergenic
1001876161 5:175202999-175203021 TGTGAGTTCCTCAAAGGCAGGGG - Intergenic
1003447668 6:6199822-6199844 TTGCAGTTCTTCAGGGGTGGGGG - Intronic
1004498878 6:16191223-16191245 TTGGAATTCTGCAAAGGTAGGGG - Intergenic
1005062281 6:21787770-21787792 TTTTGGTTCTTCAAAGGTAAGGG - Intergenic
1007323924 6:41046072-41046094 TTTCAGTTGTTCCAGAGTAGGGG - Intronic
1007826372 6:44603883-44603905 TTGATGTTCTTCAAGGGAAGTGG + Intergenic
1007952206 6:45882400-45882422 CTTGAGGTTTTCAAGGGTGGTGG - Intergenic
1008072798 6:47114510-47114532 TTTTAGTTCATCAATGGGAGTGG + Intergenic
1009034101 6:58095789-58095811 TTAGAGTTCTTCAAAGAAAGAGG + Intergenic
1011222827 6:85074690-85074712 TTTGACTTCTTGCAGGCTAGTGG + Intergenic
1011632583 6:89341356-89341378 TTTGCTTTTTTCAAGGTTAGGGG + Intronic
1012524625 6:100162360-100162382 ATTCAGGGCTTCAAGGGTAGAGG + Intergenic
1012994102 6:105956662-105956684 TATGAGTTCTTTAAGGGTAAGGG - Intergenic
1014273613 6:119362358-119362380 TTTGAATTCTTCACTGGTGGTGG + Intergenic
1015231972 6:130924917-130924939 TATGAATTCCTCGAGGGTAGAGG - Intronic
1017237970 6:152137197-152137219 TTAGAGTTCAGCCAGGGTAGGGG + Intronic
1017794138 6:157825862-157825884 TTTGTCTTCTTCAAGGGGTGGGG + Intronic
1020040910 7:5000206-5000228 TTTGAGGCTTTCAAGGGAAGAGG + Intronic
1020987925 7:15159221-15159243 TTTTAGTTATTCAAGGGGATAGG + Intergenic
1021091470 7:16487570-16487592 TTTGAATTCTTCAAAGAAAGAGG - Intronic
1022770740 7:33470056-33470078 TGTAAGCTCTTCGAGGGTAGAGG + Intronic
1024492086 7:49997037-49997059 ATTGAGTTCTTCAAGGATGCTGG + Intronic
1025758339 7:64367176-64367198 TTGGACTTCTCCGAGGGTAGAGG - Intergenic
1026014760 7:66664438-66664460 TTTTAATTAGTCAAGGGTAGTGG + Intronic
1026336218 7:69396339-69396361 TTTGAGTTCTTCAAAAGAAAAGG - Intergenic
1031187137 7:118496815-118496837 TCTGAATTCTTCTAGGGTAGTGG + Intergenic
1031438039 7:121757012-121757034 TTAGAGTTTTTCAACGGCAGAGG + Intergenic
1033068508 7:138179849-138179871 TCAGTCTTCTTCAAGGGTAGGGG - Intergenic
1040446256 8:47497727-47497749 TATTAGTTCTACAAGGGTAAAGG + Intronic
1040861240 8:52001449-52001471 TTTGAGTTCTGCTAGTCTAGAGG - Intergenic
1042160871 8:65893655-65893677 TCTGTGTTCATCAAGGATAGTGG - Intergenic
1042869742 8:73387421-73387443 TTTGACTTCTTCAGGTGTAAAGG + Intergenic
1042981809 8:74538042-74538064 ATTGAGTTCATCAAGGATATTGG + Intergenic
1043152248 8:76732526-76732548 TTGGAGTTCTTCAAAAGCAGTGG + Intronic
1044540657 8:93405135-93405157 TTTGAGTTCTTCATTTGTAAAGG + Intergenic
1044893666 8:96864483-96864505 TCTGTGTTCTTAAAGGGTACGGG + Intronic
1048209243 8:132441147-132441169 TTTGAGGTCTTCAAGTGTTGGGG - Intronic
1050196309 9:3087790-3087812 TTTGATTTCTTCTAGGCAAGAGG - Intergenic
1051138897 9:13955873-13955895 TTTGAGGTCTTCAGGTGTATAGG + Intergenic
1051815606 9:21102048-21102070 TTTGAATTGTTCATGGCTAGTGG + Intergenic
1052497949 9:29252012-29252034 TTTGATTTCTTCAAATGTTGGGG - Intergenic
1052977642 9:34423179-34423201 TATGAGCTCTTCATGGGCAGGGG - Intronic
1055139362 9:72858377-72858399 TTTGAGCTGTTCAAGGCCAGAGG + Intergenic
1058984515 9:110198576-110198598 TTTGAGTTCTGCCACGGTCGTGG + Intronic
1059063038 9:111053416-111053438 TTTAAGCTCTTCAGGGTTAGAGG + Intergenic
1059463956 9:114453878-114453900 TTTGTGTTCATGAAGGATAGTGG - Intronic
1059899012 9:118901495-118901517 TTTGAGTCATTCATGGCTAGAGG + Intergenic
1061575946 9:131506243-131506265 TTTGAGGTCCTGAAGGGTAGGGG - Intronic
1186990773 X:15064804-15064826 TGTGAATTCCTCAAGGGTAAAGG - Intergenic
1187956768 X:24526260-24526282 TTTGAGTTGTTCAAGGTAAGTGG + Exonic
1188532609 X:31159164-31159186 TGTGAGCTCTTCAAGGGTAAGGG - Intronic
1191671012 X:63749024-63749046 TTTGGGATCTTCAAGGTGAGAGG - Intronic
1192765680 X:74137671-74137693 TTTGATTGCTTCTAGGCTAGAGG - Intergenic
1194281652 X:91961049-91961071 TTTGTGTTCATCAAGGATATTGG - Intronic
1195013652 X:100757003-100757025 TTTGTGTTCATCAAGGATATTGG - Intergenic
1195432541 X:104805392-104805414 ACTGAGACCTTCAAGGGTAGGGG + Intronic
1195853041 X:109303914-109303936 TGGGAACTCTTCAAGGGTAGGGG - Intergenic
1197652068 X:129076003-129076025 TTTGAGTTCCTCTAAGGAAGTGG + Intergenic
1197752054 X:129971508-129971530 TTTTAGTTCTTTAAGGAAAGAGG + Intergenic
1198825906 X:140697623-140697645 TTTGAGCTCTTCAAAGCCAGGGG + Intergenic
1200551773 Y:4587130-4587152 TCTGTGTTCATCAAGGGTATTGG + Intergenic
1200599245 Y:5185704-5185726 TTTGTGTTCATCAAGGATATTGG - Intronic
1200952697 Y:8916225-8916247 TTTGAGGTATTCAAAGGAAGAGG + Intergenic
1201058734 Y:10022315-10022337 TTTGAGTTATTCAAAGGAAAAGG - Intergenic
1201227876 Y:11835548-11835570 ATTGAGCTCCTCAAGGGCAGAGG + Intergenic