ID: 1072188074

View in Genome Browser
Species Human (GRCh38)
Location 10:93060929-93060951
Sequence GGGAGGTGCCCCGCGGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 269}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072188064_1072188074 5 Left 1072188064 10:93060901-93060923 CCAAAGGGTGCTGAGCCCGGGAG 0: 1
1: 1
2: 0
3: 19
4: 167
Right 1072188074 10:93060929-93060951 GGGAGGTGCCCCGCGGAGCCGGG 0: 1
1: 1
2: 1
3: 22
4: 269
1072188070_1072188074 -10 Left 1072188070 10:93060916-93060938 CCCGGGAGGAGGTGGGAGGTGCC 0: 1
1: 1
2: 8
3: 114
4: 828
Right 1072188074 10:93060929-93060951 GGGAGGTGCCCCGCGGAGCCGGG 0: 1
1: 1
2: 1
3: 22
4: 269
1072188057_1072188074 21 Left 1072188057 10:93060885-93060907 CCTTCCCTTCTTCTATCCAAAGG 0: 1
1: 0
2: 1
3: 40
4: 306
Right 1072188074 10:93060929-93060951 GGGAGGTGCCCCGCGGAGCCGGG 0: 1
1: 1
2: 1
3: 22
4: 269
1072188056_1072188074 24 Left 1072188056 10:93060882-93060904 CCTCCTTCCCTTCTTCTATCCAA 0: 1
1: 2
2: 7
3: 80
4: 1046
Right 1072188074 10:93060929-93060951 GGGAGGTGCCCCGCGGAGCCGGG 0: 1
1: 1
2: 1
3: 22
4: 269
1072188061_1072188074 16 Left 1072188061 10:93060890-93060912 CCTTCTTCTATCCAAAGGGTGCT 0: 1
1: 0
2: 0
3: 13
4: 176
Right 1072188074 10:93060929-93060951 GGGAGGTGCCCCGCGGAGCCGGG 0: 1
1: 1
2: 1
3: 22
4: 269
1072188055_1072188074 25 Left 1072188055 10:93060881-93060903 CCCTCCTTCCCTTCTTCTATCCA 0: 1
1: 4
2: 54
3: 977
4: 10044
Right 1072188074 10:93060929-93060951 GGGAGGTGCCCCGCGGAGCCGGG 0: 1
1: 1
2: 1
3: 22
4: 269
1072188060_1072188074 17 Left 1072188060 10:93060889-93060911 CCCTTCTTCTATCCAAAGGGTGC 0: 1
1: 0
2: 0
3: 10
4: 140
Right 1072188074 10:93060929-93060951 GGGAGGTGCCCCGCGGAGCCGGG 0: 1
1: 1
2: 1
3: 22
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072188074 Original CRISPR GGGAGGTGCCCCGCGGAGCC GGG Intergenic
900113522 1:1019551-1019573 GGGAGCTGCGGCGCGGAGGCGGG - Intergenic
900146919 1:1162520-1162542 GGAAGGAGCCCTGCGGAGCTGGG + Intergenic
900466820 1:2829830-2829852 GAGAGGAGCACCGCAGAGCCTGG - Intergenic
900653277 1:3741843-3741865 GGGTGGTGGCCAGCGGAGCAGGG + Intergenic
901325074 1:8360842-8360864 GGGAGGTCCCCAGAGGGGCCTGG + Exonic
901381863 1:8879330-8879352 GGCGGGTGCCAGGCGGAGCCCGG - Intergenic
901428640 1:9199112-9199134 GGGAGGTGTCCCGGAGAGCCTGG + Intergenic
901497617 1:9630894-9630916 GGGAGGTGACCCTGGGAGGCTGG + Intergenic
901527954 1:9835914-9835936 GGGAGGAGCCCGGAGCAGCCTGG + Intergenic
902747484 1:18483240-18483262 GGAGGGTGCCCTGCGGGGCCGGG - Exonic
905033796 1:34904533-34904555 GGGAGGCCCCCTGGGGAGCCTGG - Exonic
905346045 1:37311799-37311821 AGGAGGTGCCTCGGGGTGCCTGG - Intergenic
906676268 1:47695726-47695748 GGCAGGTGCCCAGCAGAGGCTGG + Intergenic
907136256 1:52142165-52142187 CGGAGGAGCGCCGCCGAGCCGGG - Exonic
908341385 1:63183512-63183534 GGGAGGAGCCCCTCGATGCCTGG - Intergenic
912270188 1:108200450-108200472 GGGAGGTGCTGTGCGGACCCGGG + Intronic
914250606 1:145918701-145918723 GGGAGCAGGGCCGCGGAGCCTGG - Exonic
914361428 1:146939112-146939134 CGGCGGAGCCCTGCGGAGCCCGG - Intronic
914491177 1:148151598-148151620 CGGCGGAGCCCTGCGGAGCCCGG + Intronic
915951073 1:160190353-160190375 GGAAGGAGCCCCTGGGAGCCTGG + Intergenic
917930827 1:179821444-179821466 GGGAGAAGCCCAGTGGAGCCAGG - Intergenic
920002172 1:202807754-202807776 GGGAGTTTCCTCACGGAGCCTGG - Intronic
920255656 1:204652343-204652365 GGGAGGTGACCAGCTGAACCGGG - Intronic
920401828 1:205680764-205680786 GGGAGGTGCCCCGCGAAGCCGGG - Intergenic
921715279 1:218411442-218411464 GGGAGGAGCCCAGCTGAGCCCGG - Intronic
922705335 1:227787584-227787606 GAGGGGGGCCCCGCAGAGCCGGG + Intergenic
922788277 1:228294536-228294558 GGGAGATGCCCAGAGGACCCTGG - Intronic
1062953830 10:1526787-1526809 GGGAGGTGCCAGGAGGAGGCGGG - Intronic
1065214824 10:23439363-23439385 GGGAGGGGGCCGGCGGAGCGCGG - Intergenic
1066220849 10:33335466-33335488 GGGAGCCGCACCGCGAAGCCGGG + Intronic
1067055305 10:43046436-43046458 GGGAGGTTCCCCTTGGAGCCTGG + Intergenic
1067537418 10:47124057-47124079 GGGCTGTGCCCCGTGGAGCCAGG + Intergenic
1070799405 10:79236325-79236347 GGGAGGTGTGCCGCACAGCCAGG + Intronic
1070811358 10:79299676-79299698 CGGAGGTTCCCTGCTGAGCCAGG + Intronic
1072188074 10:93060929-93060951 GGGAGGTGCCCCGCGGAGCCGGG + Intergenic
1072578444 10:96720484-96720506 GGCCGGTCCCGCGCGGAGCCCGG - Exonic
1072916552 10:99540604-99540626 GGGAGAAGCCCCGCGGAGAGGGG - Intergenic
1074850953 10:117439257-117439279 GAGAGGGGCCCAGCTGAGCCTGG + Intergenic
1075629913 10:123994691-123994713 GAGAGGTGAGCCGCGAAGCCAGG + Intergenic
1075729915 10:124630003-124630025 GGGAAGGGCCCTGCAGAGCCTGG - Intronic
1077107361 11:848008-848030 GGCAGGTGCCACGGGGACCCGGG - Intronic
1077230699 11:1457090-1457112 GGCAGGTCCTCGGCGGAGCCAGG + Intronic
1077545003 11:3165348-3165370 GGGAGGAGGCCCAGGGAGCCCGG + Exonic
1078246093 11:9574126-9574148 GCGCGGAGCCCCACGGAGCCCGG + Exonic
1080606862 11:33870613-33870635 GGGAGGGACCACGCGGGGCCGGG + Intronic
1080633770 11:34105640-34105662 GGGACGCGTGCCGCGGAGCCAGG + Exonic
1081756931 11:45551379-45551401 GGGCTGGGCCCCGCTGAGCCAGG + Intergenic
1082860206 11:57848183-57848205 GGGATGGGACCCGCTGAGCCAGG - Intergenic
1083264939 11:61542320-61542342 CCGAGGTGCCCTGCCGAGCCTGG + Intronic
1083934238 11:65862091-65862113 GGGAGGTTCCCCGAGGGGCCTGG + Intronic
1084423652 11:69072726-69072748 GGGAGGAGCCCAGAGGAGGCTGG - Intronic
1085533111 11:77203232-77203254 GGGCTGTGCCCAGGGGAGCCAGG + Intronic
1089151643 11:116369042-116369064 GGGAGGTTCCACAAGGAGCCGGG - Intergenic
1089262542 11:117232647-117232669 GGGAGGTGCCGCGCGCGGGCCGG + Exonic
1089457731 11:118635075-118635097 GGGGCGTGGCCCGCGGGGCCGGG - Intronic
1089563028 11:119355412-119355434 GGCTTGTGCCCCGTGGAGCCTGG - Exonic
1089983495 11:122791730-122791752 GGGAGTTGCCCAGGGGATCCAGG + Intronic
1091763282 12:3101835-3101857 GGGAGGCTCCCAGCGAAGCCTGG + Intronic
1092860734 12:12717285-12717307 GGGAGCCGCCCCGCCGAGGCTGG - Exonic
1093894818 12:24563327-24563349 GGGACGCGCGGCGCGGAGCCTGG - Intergenic
1094831510 12:34302416-34302438 GTGAGGTGCCCCGGGCATCCTGG + Intergenic
1094831557 12:34302598-34302620 GTGCGGTGCCCCGGGGAACCTGG + Intergenic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1102375646 12:112419126-112419148 GTGAGGAGCCCCGAGGGGCCCGG + Intronic
1102521519 12:113480041-113480063 GCGAGGTTCCCCGTGAAGCCGGG + Intergenic
1103534721 12:121626692-121626714 CGGAGGTGCCTCGCGGCGCCCGG + Exonic
1103935678 12:124475246-124475268 GGGAGGTGGCCTGAGGAGCATGG - Intronic
1104893686 12:132151881-132151903 GGGAGGTGGCACGGGGAGCTGGG - Intronic
1104958035 12:132475341-132475363 GGGAGGGGCACCGCGGAGGGAGG - Intergenic
1105454159 13:20525533-20525555 TGGAGGCGCCCCGCGGAGTTGGG - Intronic
1108496912 13:51034344-51034366 GGGAGGAGCCCCGTGCAGCCTGG + Intergenic
1111518213 13:89363180-89363202 AGGAGGTGGCCGCCGGAGCCGGG - Intergenic
1114211905 14:20622987-20623009 GGGAGGCACCGCGGGGAGCCCGG + Intergenic
1119725861 14:76921467-76921489 GAGAGGTGACCCGAGGAGTCAGG - Intergenic
1121441042 14:93949613-93949635 GGCAGGTGCCCTGGAGAGCCTGG + Intronic
1121629925 14:95414441-95414463 GGGAGGTGCCCAGTGGTGGCGGG - Intronic
1127595565 15:60478861-60478883 GGTAGGAGCCGCGCAGAGCCAGG + Intronic
1130040870 15:80404454-80404476 GGGAGGGGCGGCGCGGAGCCCGG - Exonic
1132462221 16:61321-61343 TGGAGGTGCCCGGCGGGGGCAGG - Intronic
1132696036 16:1202371-1202393 GGGCCGTGCCCCCCGGTGCCTGG - Exonic
1132739510 16:1404452-1404474 CACAGGTGCCCAGCGGAGCCTGG - Intronic
1132803117 16:1763808-1763830 GGGCGGGGCCCCGCAGAGGCGGG + Intronic
1132831418 16:1930070-1930092 GGCAGGTGCCGCGCAGAGCCTGG - Intergenic
1132863156 16:2081377-2081399 CTGAGGTGCCTGGCGGAGCCTGG + Intronic
1132899322 16:2244673-2244695 GGGTGCTGCCCCACAGAGCCAGG + Intronic
1132950540 16:2559860-2559882 GGGAGGTGCCCGGGAGAGCACGG + Intronic
1132963808 16:2640310-2640332 GGGAGGTGCCCGGGAGAGCACGG - Intergenic
1135536966 16:23302190-23302212 GGGAGGTGGCCAGGGGAGCCGGG + Intronic
1136220060 16:28823114-28823136 GGGGGGAGCCCCGCGGTGTCGGG - Exonic
1136520623 16:30793557-30793579 AGGAGGTGACCAGCGGAGCCGGG + Intergenic
1136550335 16:30979454-30979476 AGGAGGTGTCCCGAGGAGGCCGG + Exonic
1137288813 16:47037857-47037879 GGAAGCTGCCCCGCGGCGCGCGG + Intergenic
1137767899 16:50991806-50991828 GGGAGGTGCCCAGCTGAACTCGG - Intergenic
1138363354 16:56451619-56451641 GGGAAGCGGCCAGCGGAGCCCGG + Exonic
1139446217 16:67000342-67000364 GGGAGGTGCCCAGGGCAGGCAGG + Intronic
1139493909 16:67302275-67302297 AGGAGGGGCCCGGCCGAGCCTGG + Intronic
1141054449 16:80803536-80803558 GGGAGGTGGCCCGGGGACCCCGG + Intronic
1142010080 16:87709477-87709499 CGGGGCTGCCCCGCCGAGCCTGG + Exonic
1142198852 16:88751504-88751526 GGGCGGTGCCCCCCGGAGCCCGG - Intronic
1142491213 17:281006-281028 GGGAAGTGCCCTGGGGAGGCAGG - Intronic
1142738620 17:1917541-1917563 GGGAGGTGCCCTACGGCGCATGG + Intergenic
1143519472 17:7437400-7437422 GGCCGGGTCCCCGCGGAGCCGGG - Exonic
1143630771 17:8139029-8139051 GGGTGGAGCCGGGCGGAGCCGGG - Intergenic
1144007615 17:11115262-11115284 GGGAGGCGCCCTGCAGAGCTGGG - Intergenic
1144262619 17:13537435-13537457 GGGAGGCGGCCCCCGGAGCCTGG - Intronic
1145077437 17:19867586-19867608 GGAAGCTGCCGCGCGGAGCCAGG + Exonic
1145317293 17:21742620-21742642 GGGAGGTGCCCGGCCAACCCAGG + Intergenic
1146660088 17:34659807-34659829 AGGAGGAGCCCAGCTGAGCCTGG - Intergenic
1147663879 17:42133122-42133144 GGGAGGAGCCGCCCAGAGCCAGG + Intronic
1148000859 17:44386097-44386119 GGTGGGCGCCCCGCGGACCCTGG - Exonic
1151326825 17:73384896-73384918 GGGAGGTGCCCATGGCAGCCGGG - Intronic
1151628026 17:75289659-75289681 AGGAGGTGCCTTGCGAAGCCGGG + Intergenic
1152202918 17:78957515-78957537 GGAAGGTCCCCCTGGGAGCCAGG + Intergenic
1152242500 17:79167800-79167822 TGGAGGTGCCCCCGGGACCCTGG + Intronic
1152321386 17:79610357-79610379 CGGACGCGCCCCGCGGGGCCGGG + Intergenic
1152723560 17:81934528-81934550 GGGCAGTGCCCCGCAGAGGCAGG - Intronic
1152929703 17:83103484-83103506 GGGCGGGGCCCCGAGGAGACAGG - Intergenic
1154411893 18:14146110-14146132 GGCAGGTGCCCCCCAGACCCTGG - Intergenic
1155579785 18:27290272-27290294 GGGGGGTGCCCAGGGGAGGCTGG + Intergenic
1156399561 18:36728228-36728250 GGTAGGTGCCCAGCAGTGCCCGG + Intronic
1157563252 18:48663386-48663408 GGGAGGGGCTCTGCAGAGCCAGG - Intronic
1158953787 18:62522322-62522344 GGGAGGTGCGCAGCGGGACCCGG - Intergenic
1160235934 18:77087235-77087257 GGGAAAACCCCCGCGGAGCCTGG + Intronic
1160541927 18:79628587-79628609 GGGAGGTGGCCCCAGGAGGCAGG - Intergenic
1160679894 19:407798-407820 GGCAGCTGCCCGGCGGCGCCCGG + Exonic
1160719366 19:590605-590627 GCGAGGGGGCCCGGGGAGCCGGG + Intronic
1160730319 19:639095-639117 GGGTGGTTCCCCGTGGGGCCTGG + Intergenic
1160807846 19:1000486-1000508 GGGTGGCCCCCCGCGGACCCCGG - Exonic
1160813851 19:1026558-1026580 GGGGCGTGGCGCGCGGAGCCCGG + Intergenic
1160832497 19:1110330-1110352 AGCAGGTGCCCCGTGAAGCCTGG + Intronic
1160967617 19:1753537-1753559 GGGCCGTGCGCCGCGCAGCCTGG + Exonic
1161170662 19:2810902-2810924 GGGCTGTCCCCCGAGGAGCCTGG - Intronic
1161237804 19:3206459-3206481 GGGAGGTCCCCCTCGGCCCCAGG - Intronic
1161262526 19:3345657-3345679 GGGAGGAGCCATGGGGAGCCGGG - Intergenic
1161752945 19:6110610-6110632 GGAAGGTGGGGCGCGGAGCCTGG - Intronic
1161809795 19:6465126-6465148 GGGAGGAGGCCTGCCGAGCCGGG + Intronic
1162031123 19:7917674-7917696 GGGAAGTGCCACGCTGAGACTGG - Intronic
1162131247 19:8527342-8527364 GGGAGACTCCCCGCAGAGCCTGG + Exonic
1162284438 19:9727654-9727676 GGGTGGTGCTCCGTGGAGACTGG + Intergenic
1162374398 19:10296286-10296308 GGGAGAAGCCCCCCGGAGCTTGG + Intronic
1162914935 19:13869532-13869554 GGGAGGTGGCCTGCGGAGGGTGG + Intronic
1162967192 19:14161520-14161542 GAGGGGTGCCCGGCGGAGCGGGG + Exonic
1163034189 19:14562081-14562103 GGGAGTCTCCCCGGGGAGCCAGG - Intronic
1163312707 19:16523457-16523479 GGGACAGGCCCCTCGGAGCCTGG - Intronic
1163830332 19:19544493-19544515 TGCAGCTGCTCCGCGGAGCCGGG - Exonic
1165154174 19:33777417-33777439 GGCAGGCGCCCCGGGGAGCAGGG + Intergenic
1165327825 19:35124584-35124606 GGGAGGTGTCGCGGGGAGCCTGG - Exonic
1165447025 19:35861993-35862015 GGGAGGTGCCCAGGCCAGCCTGG + Exonic
1165913663 19:39244872-39244894 CGGGAGAGCCCCGCGGAGCCTGG + Exonic
1166084497 19:40466020-40466042 GGGAGGTGGAGCGCGGAGGCAGG - Intergenic
1166931424 19:46303806-46303828 GGGAGCTGCCACGTGGGGCCGGG - Intronic
1167577306 19:50323951-50323973 CGGAGGTGCCCCGGGGATCGGGG + Exonic
1168178538 19:54643660-54643682 GGGAGGGACCCCGAGGAGGCAGG + Intronic
927207054 2:20617380-20617402 GGGAGCTGACCCTCTGAGCCTGG + Intronic
929044508 2:37776803-37776825 GGGAGGTGCCCTGGGGGTCCAGG + Intergenic
929225924 2:39511533-39511555 GGGAGGTGACCAGAGGACCCAGG - Intergenic
934573109 2:95384480-95384502 GGGAGGAGACCAGGGGAGCCTGG - Exonic
934854971 2:97724040-97724062 GGCAGGTGCGCCGCGGGGTCTGG - Exonic
934942029 2:98509664-98509686 GGGAGGTGCCAGGAGCAGCCTGG - Intronic
935196681 2:100820380-100820402 CGGAGCGGCCCCGCGGGGCCGGG - Exonic
938900370 2:135794432-135794454 GGGAGGTGCCCTGGAGACCCCGG + Intronic
938977607 2:136494739-136494761 GGAAGGTGCACCGAGGGGCCTGG + Intergenic
942045841 2:172099079-172099101 AGGAGGTCCCCCGCGGCGGCTGG + Intergenic
942268260 2:174248730-174248752 GGGAGGAGCCGCGCGGCGGCAGG + Intergenic
944271306 2:197786788-197786810 TGGAGGTGCTCAGCGGGGCCGGG - Intergenic
945664170 2:212721096-212721118 GGGACTGGCCCCGCGGAGCAGGG + Intergenic
946163197 2:217848342-217848364 GGGAGGGGCCCCACCCAGCCTGG - Exonic
946418545 2:219552428-219552450 GGGCGGGGCCCGTCGGAGCCAGG + Intronic
947729643 2:232420830-232420852 GGCAGGTGCGCGCCGGAGCCTGG + Intergenic
947732685 2:232439877-232439899 GGGAGGTCCCCAGTGGAGTCTGG - Intergenic
947860026 2:233352267-233352289 GGGAGGTGAGCAGCGGCGCCAGG - Intergenic
948503013 2:238408568-238408590 GGGAGGTTCCCCACGGTGCAAGG + Intergenic
948901484 2:240958778-240958800 GGGTGGTGTCCCGAGGGGCCTGG + Intronic
948982051 2:241499445-241499467 GGGTGGAGCCACGTGGAGCCTGG - Intronic
1168756933 20:324751-324773 GCGAGGTGCCCCGCGGCCCTTGG + Intergenic
1170477498 20:16730236-16730258 GGGAGCTGCCACGCGATGCCCGG - Intronic
1171767926 20:29300474-29300496 GAGAGGTGGACCGCGGTGCCTGG + Intergenic
1171768266 20:29301692-29301714 GGGAGGGGGCCCGCGGTACCAGG + Intergenic
1171810976 20:29743936-29743958 GGGAGGGGGCCCGCGGTACCAGG + Intergenic
1172445177 20:34989655-34989677 GGGAGGTGGCCTGGGGAACCAGG + Intronic
1172618983 20:36307227-36307249 GTGCGGCGCCCCGCGGAGACAGG + Intronic
1172654307 20:36527676-36527698 GGGAGGTGCCCCGCCAGCCCTGG + Exonic
1174204414 20:48828238-48828260 CGGAAGGGCCCCGCGGAGCCGGG + Intergenic
1174411490 20:50339522-50339544 GGGATGTGCCAGGCAGAGCCAGG + Intergenic
1174956760 20:55106235-55106257 GGGAGGTGCCCCCAGGACACAGG - Intergenic
1175328705 20:58148016-58148038 GGGAAGTGCCCCACGGGGGCTGG + Intergenic
1175424641 20:58855663-58855685 GGGAGGGGCCCCGGGGCCCCGGG + Intronic
1175768264 20:61606146-61606168 GGGAGGTGCCCTGCAAACCCTGG - Intronic
1176022051 20:62966981-62967003 AGGAGGTGTCCCGGGGACCCTGG - Intronic
1176086472 20:63297592-63297614 GGGAGGACCCCCGGAGAGCCAGG + Intronic
1176180869 20:63748700-63748722 GGGAGGAGCCGAGGGGAGCCTGG - Intronic
1179030960 21:37719092-37719114 AGGAGGAGCCCCGAGGGGCCAGG + Intronic
1179675012 21:42975049-42975071 GGGCGGGGGCGCGCGGAGCCCGG + Intronic
1179729150 21:43357912-43357934 GGGAGCTGCCCCGAGGGTCCTGG - Intergenic
1179893698 21:44350275-44350297 GGTAGGTGCCCGCCGGGGCCGGG + Intronic
1180045232 21:45302106-45302128 GGGAGGTGCCGGGCACAGCCAGG - Intergenic
1180074601 21:45456195-45456217 GGGAGGGGCCCCGCCCAGCAAGG - Intronic
1180078739 21:45476367-45476389 GGGGGGTGGCGCGGGGAGCCTGG - Exonic
1180135534 21:45859672-45859694 GGGAGGTGCCCAGCCGAGTGTGG - Intronic
1180871597 22:19149982-19150004 GCGCGGGGCCCGGCGGAGCCCGG - Intronic
1181811386 22:25405530-25405552 GGGAGGGGCCGCGGGGACCCGGG - Intergenic
1183256251 22:36764273-36764295 CGGAAGTGCCCAGCAGAGCCTGG - Intronic
1183395027 22:37566667-37566689 GGGAGATGGCCGGTGGAGCCGGG - Exonic
1183702367 22:39457645-39457667 GGGGAGTGGGCCGCGGAGCCGGG - Intronic
1184294988 22:43517438-43517460 GTGAGGTGCTCTGCTGAGCCTGG + Intergenic
1184668248 22:45999763-45999785 GGGACGCGCCCACCGGAGCCTGG - Intergenic
1184788739 22:46686020-46686042 GAGGGGTGCCCCGGGGAGCGCGG + Exonic
1185039059 22:48495159-48495181 GGAAGGAGACCCGCAGAGCCAGG - Intronic
1185087980 22:48750964-48750986 AGGTGGTGCCCCGCGGACCCCGG + Intronic
1185218183 22:49615541-49615563 GGGAGGTGTCTCGGGCAGCCGGG - Intronic
1185272266 22:49934994-49935016 GGGAGGATCCCCCCAGAGCCAGG + Intergenic
1185333480 22:50261711-50261733 GGGAGGGGCCGTGCGCAGCCTGG - Exonic
1185409623 22:50674856-50674878 GGGCGGGGCCCCGGGAAGCCCGG + Intergenic
950005846 3:9690438-9690460 GGGAGGTGCGCCTAGGAGGCTGG - Intronic
950586424 3:13895537-13895559 GGGTGGAGCCGAGCGGAGCCGGG + Intergenic
952241127 3:31532569-31532591 GGGAGGAGCCCCCTGGAGTCCGG - Intergenic
953778278 3:45842034-45842056 AGGCGGTGCCCCGCCAAGCCTGG + Exonic
955161325 3:56467952-56467974 GGGAGGTGGCCCGGGCAGCCGGG + Intronic
960120921 3:113948034-113948056 GGGAGCGGCCGAGCGGAGCCCGG + Exonic
960960488 3:123067300-123067322 GGGAGCTGCCCCGGGGCACCGGG + Intronic
961775093 3:129278878-129278900 GGGAGGTGACGCGCGCTGCCGGG + Exonic
966182237 3:177197669-177197691 GGGAGGGGCGCCGCGGACGCCGG + Intergenic
966874758 3:184315440-184315462 GTCTGGGGCCCCGCGGAGCCAGG + Exonic
967886780 3:194338712-194338734 ACGAGGTGCCCCGGGGAGCAGGG - Intergenic
968547993 4:1208304-1208326 GGGTGGGGCCCCGAAGAGCCTGG + Intronic
968943200 4:3650036-3650058 AGCAGGTGCCCCTGGGAGCCAGG - Intergenic
969276106 4:6136963-6136985 GGGAGGTGGCATGGGGAGCCAGG + Intronic
969538072 4:7768876-7768898 GGGAGCTGCCCGGGGCAGCCTGG + Exonic
972396708 4:38664264-38664286 GAGCGGAGCCGCGCGGAGCCGGG + Exonic
979674765 4:123398652-123398674 GGGAGGGGCCGCGCCGAGCGAGG - Intronic
995735646 5:115296822-115296844 GCAAGGTGCCGGGCGGAGCCGGG + Exonic
997523489 5:134538126-134538148 GTGAGCTGCCCTGCGGAGACTGG + Intronic
1001206350 5:169766901-169766923 GGGAGGTGCACCACTGTGCCTGG + Intronic
1001717003 5:173824498-173824520 GGCAGCTACCCCGCAGAGCCTGG - Intergenic
1005866890 6:29943547-29943569 GGGAGGCGCCCCGTGGCCCCTGG - Intronic
1005883136 6:30075161-30075183 GGGAGGTTCCCGGGGAAGCCGGG - Intronic
1005928907 6:30466344-30466366 CGGAGGAGCGCCGCGGAGCAGGG - Intergenic
1006511769 6:34525487-34525509 GGGAGGTGTCCCCTGGTGCCGGG + Intronic
1007784324 6:44271117-44271139 GGGCGGAGCCTCGCGGATCCTGG + Intronic
1014272629 6:119350129-119350151 GAGAGGTCCCGCGCGGACCCAGG - Intergenic
1019409294 7:899662-899684 GGGAGGTGCCGTGTGGAGGCTGG - Intronic
1019471567 7:1224108-1224130 GGCAGGTCCTCCTCGGAGCCTGG - Intergenic
1019513223 7:1428863-1428885 GGGAGGGTCCCCGGGGAGCAGGG + Intronic
1019561962 7:1663934-1663956 GGCAGGGCCCCCGCGGGGCCTGG - Intergenic
1020213550 7:6172205-6172227 AAGAGGAGCCCCGCGGGGCCAGG - Intronic
1021848843 7:24788282-24788304 GAGTGGTGCCCCGAGGAGACAGG + Intergenic
1023043586 7:36193455-36193477 GGGAGGTCCCCCGGGGAGTGCGG + Intronic
1024023313 7:45390414-45390436 GGGAGGTGGCCCGAGAAACCAGG + Intergenic
1024085541 7:45889040-45889062 GGGAGGTGCCGGGCGGGGGCGGG - Intronic
1026136867 7:67671170-67671192 GGGAGGTCTCCCGTGGAGCACGG + Intergenic
1026807347 7:73436534-73436556 GGTGGGGGCCCCGAGGAGCCAGG - Intergenic
1029497305 7:100902894-100902916 GAGAGGTGCCCAGCAGGGCCAGG + Intergenic
1032237924 7:130140889-130140911 GGGAGGTGGCCCCCGCAGCCCGG + Intergenic
1033648361 7:143321878-143321900 GGGAGGGGCCCTCAGGAGCCAGG + Intronic
1034105105 7:148483414-148483436 GAGAGGTTCACCGCAGAGCCTGG + Intergenic
1034310901 7:150086717-150086739 GGGAGGTGGCCCTCGGTGGCTGG + Intergenic
1034936764 7:155204894-155204916 GGAAGGTGCTCCGCAGAGCCAGG - Intergenic
1035049396 7:155990010-155990032 GGGAGGTGCTACACGGAGCTAGG + Intergenic
1038266575 8:26043252-26043274 GGGAGCTGCCCTGCGGCGCTGGG + Intronic
1039873689 8:41567673-41567695 GGACGGTGGCCCGCGGGGCCAGG - Intergenic
1039875166 8:41578542-41578564 GCGAGGGGCTCCGAGGAGCCGGG - Intronic
1039899826 8:41743557-41743579 GGGAGGTGCCCTGCAGGGCATGG + Intronic
1039996783 8:42541383-42541405 GGGAGGCGGCGCGCGCAGCCCGG + Intronic
1042246406 8:66712812-66712834 GGGAGCAGCACCGCGGGGCCAGG + Intronic
1042859064 8:73295098-73295120 GGGAGTGGCCCCGCGCAGGCAGG + Exonic
1045673955 8:104588560-104588582 GGGAGGGCCCCGGCGGAGCGAGG - Intronic
1048447819 8:134505001-134505023 GGGAGGTGGCCCAGGGACCCAGG - Intronic
1049442633 8:142616256-142616278 CGGAGGGGCACCGCGGAGCTGGG + Intergenic
1049476885 8:142801029-142801051 GGGAGGTGCCCAGTGGGGCAGGG + Intergenic
1049536781 8:143186195-143186217 GGCAGGAGCCGCGGGGAGCCGGG - Intergenic
1057573149 9:96219186-96219208 GGGAGGCGCCCAGAGGAGCGGGG - Intergenic
1057781921 9:98056989-98057011 GGGCGGGGCCGCGGGGAGCCAGG + Intronic
1058951256 9:109906045-109906067 AAGAGGTGCCCCGTGGTGCCTGG + Intronic
1059385095 9:113958404-113958426 GGGAGGTGCCCAGTGGATGCTGG + Intronic
1059405216 9:114095040-114095062 GGGTGGTGACCCGCTGAGCTCGG + Exonic
1060523761 9:124309061-124309083 GGCAGCTGCCCCCAGGAGCCTGG + Intronic
1060797554 9:126522846-126522868 GCAAGGTGCCCTGCGCAGCCTGG + Intergenic
1061261438 9:129482816-129482838 GGGAGTCACCCCGCGGGGCCCGG + Intergenic
1061388171 9:130302724-130302746 GAGAGGTGACCAGGGGAGCCAGG + Intronic
1061444124 9:130628192-130628214 GAGAGGAGCCCCACGCAGCCAGG + Intronic
1061721823 9:132556653-132556675 AGGCGGTGCACCGCGGGGCCAGG - Intronic
1061853712 9:133429982-133430004 GGCGGGTGCCCCGCGGACCCGGG - Exonic
1061917460 9:133762798-133762820 GGGAGGTGCCCGGCCCAGGCTGG - Exonic
1061941512 9:133886663-133886685 TGCAGGTGCCCCGCGGAGCAGGG - Intronic
1062091618 9:134681384-134681406 GGCAGGGGCCCCGCACAGCCCGG - Intronic
1062191925 9:135252513-135252535 GGGCGGTGCCTGGCAGAGCCGGG + Intergenic
1062241853 9:135545191-135545213 GGGATGAGGCCAGCGGAGCCAGG + Intergenic
1062284951 9:135768702-135768724 GGGAGGGGCACCGTGGGGCCGGG + Intronic
1203759302 EBV:3738-3760 GGGAGGAGCCCCACCGGGCCTGG - Intergenic
1203361268 Un_KI270442v1:220644-220666 GAGAGGTGGACCGCGGTGCCCGG + Intergenic
1189288314 X:39867519-39867541 GGGAGGAGCCCTGGGAAGCCAGG - Intergenic
1193962206 X:87939906-87939928 GAGAGGTGCCCGCTGGAGCCTGG - Intergenic
1195942125 X:110175333-110175355 GGGAGGAGCCCCTGGGGGCCTGG + Exonic
1197753080 X:129979183-129979205 GGGAGGTGCCCAGCAGTTCCTGG - Intergenic