ID: 1072188201

View in Genome Browser
Species Human (GRCh38)
Location 10:93061504-93061526
Sequence CAGTGGGAGCCGGGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 531}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072188201_1072188211 4 Left 1072188201 10:93061504-93061526 CCTTCTTCCCCCGGCTCCCACTG 0: 1
1: 0
2: 5
3: 48
4: 531
Right 1072188211 10:93061531-93061553 CTCCTCAGTCTCAATGCCCATGG 0: 1
1: 0
2: 0
3: 21
4: 193
1072188201_1072188212 5 Left 1072188201 10:93061504-93061526 CCTTCTTCCCCCGGCTCCCACTG 0: 1
1: 0
2: 5
3: 48
4: 531
Right 1072188212 10:93061532-93061554 TCCTCAGTCTCAATGCCCATGGG 0: 1
1: 0
2: 1
3: 9
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072188201 Original CRISPR CAGTGGGAGCCGGGGGAAGA AGG (reversed) Intronic
900159428 1:1216474-1216496 CAGTGGGAGCTCAGGGAAGCCGG - Intergenic
900571860 1:3362546-3362568 CGGTGGGAACCAGTGGAAGACGG + Intronic
900742780 1:4340748-4340770 AGGTGGGACCTGGGGGAAGACGG + Intergenic
900996134 1:6124611-6124633 CTGTGTGAGCCGGGGGCGGATGG - Exonic
901906821 1:12419565-12419587 GAGTGGGAGCAAGGGAAAGAAGG + Intronic
902034355 1:13446082-13446104 CAGTGGGAGTCGGAGGCAGGTGG + Intergenic
902847577 1:19123973-19123995 CACTGGCAGCAGGAGGAAGAAGG + Intronic
902917417 1:19646953-19646975 CTGTGGGAGCGAGGGGCAGAAGG + Intronic
903290417 1:22310213-22310235 CAGTGGTTGCCTGGAGAAGAGGG + Intergenic
903337653 1:22635616-22635638 CAGTGGGAGCTGGGGACAGTGGG - Intergenic
903772302 1:25771602-25771624 CCGTGAGAGCCGGCGGCAGATGG + Intronic
903982988 1:27203419-27203441 CAGTGGGAGACGCGGGAGCATGG - Intergenic
904499959 1:30908095-30908117 CACTGGGAGGTGGGGGAACAGGG + Intronic
904772169 1:32886533-32886555 CAGCCGGGGCCGGGGGATGAGGG + Intronic
904988730 1:34574018-34574040 CAGTGGGTGCCAGGGGAAGGGGG + Intergenic
905338572 1:37262336-37262358 CAGTGGGAGTCAGGGGAGAAGGG + Intergenic
905455800 1:38087191-38087213 CAGTGGGCACCAGGAGAAGAGGG + Intergenic
905966683 1:42104423-42104445 CAGTGGGCGAGGGAGGAAGAGGG - Intergenic
906697164 1:47830745-47830767 CACTGTGAGCCAGGGAAAGACGG + Intronic
906727492 1:48054729-48054751 CTGTGGGAGCTGGGGGTCGAGGG + Intergenic
907438005 1:54461938-54461960 GAGTGGGGGCTGGGGGCAGAGGG + Intergenic
907459123 1:54594743-54594765 CAGTGGGAGCCCGGGGCAGAGGG - Intronic
909925234 1:81430604-81430626 CAGTGGGGGGCTGGGGGAGAGGG - Intronic
911497766 1:98651300-98651322 CAGTGGGAGCGGGGAGAGGCTGG + Intergenic
911720340 1:101183947-101183969 CAGTGGTTGCCAGGGGGAGAAGG - Intergenic
912713236 1:111964417-111964439 CTGTGGGGGCCGGGGGAGGGAGG - Intronic
914226874 1:145728068-145728090 CACTGGGAGCCGGGGAGGGAGGG - Intronic
915969358 1:160343006-160343028 CAGACGGACCCGGAGGAAGACGG - Intronic
916507232 1:165439289-165439311 GAGTGGGAGCGAGGGGAGGAGGG + Intronic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
916606021 1:166343156-166343178 CAGGGGGAGCAGGGGGAGCAGGG + Intergenic
916722597 1:167495777-167495799 AAGTGGGAACCTGGAGAAGACGG - Intronic
917235385 1:172886267-172886289 GATTGGGAGCTGTGGGAAGAAGG + Intergenic
917618247 1:176768223-176768245 CAGGGGGAGGTGGGAGAAGAAGG - Intronic
917975749 1:180236477-180236499 GAGGAGGAGCCGGGGGAAGGAGG + Intronic
918464317 1:184806245-184806267 CAGTGGGAGCAGGAAGAAGTTGG + Intronic
920018187 1:202930691-202930713 CAGTGGGGGTTGGGGGAAGGTGG - Intergenic
920377873 1:205519031-205519053 CAATTGGTGCCAGGGGAAGAGGG - Intronic
920430727 1:205917236-205917258 GGGTGGGAGCAGGGCGAAGAGGG - Intronic
920487106 1:206381210-206381232 GAGTGGGGGATGGGGGAAGAAGG - Intronic
920516635 1:206589319-206589341 CACTGGGAGCGGGGGAGAGAGGG + Intronic
920552000 1:206869803-206869825 CAGAGTGAGGTGGGGGAAGAAGG - Intergenic
920904047 1:210142755-210142777 CAGTGGGAAATGGGGGAGGAAGG - Intronic
921970422 1:221142503-221142525 CAGTTTCAGCCAGGGGAAGAAGG + Intergenic
922240919 1:223755194-223755216 CAGTGGGAGATGGTGGGAGATGG - Intronic
922247359 1:223813540-223813562 CAGTGGGACAGGGGAGAAGAGGG - Intronic
922900814 1:229135107-229135129 CTGTGGGAGCTGTGAGAAGAGGG + Intergenic
923498547 1:234545449-234545471 CAGTGTGAGCCTGGGGGAGTGGG - Intergenic
923525851 1:234772134-234772156 CTGTGGGGGTCGGAGGAAGAAGG - Intergenic
923907504 1:238401778-238401800 CAGCCGGAGCAGGGGGAAGAGGG + Intergenic
924089443 1:240487277-240487299 CAGCAGGAGCCGGGAGAAGAAGG + Intergenic
1063695060 10:8326706-8326728 AAGTGGGAGCCGGGAGGGGAGGG + Intergenic
1063814933 10:9760593-9760615 TAGTGGGAGCAAGGGGCAGAGGG + Intergenic
1064322867 10:14321957-14321979 TGGTGGGAGCAGGAGGAAGAGGG - Intronic
1064449183 10:15426189-15426211 TGGTGGGGGCGGGGGGAAGAGGG + Intergenic
1065326826 10:24556865-24556887 CAGAGGGAGCCGCGGGTAGGTGG - Intergenic
1066276614 10:33875196-33875218 GAGTGGGAGGAAGGGGAAGAGGG + Intergenic
1066746191 10:38605301-38605323 CAGTGGGAGCCGGGGCCCCAGGG - Intergenic
1067095798 10:43298750-43298772 CAGTGGGAGGTGGGGGAACCAGG - Intergenic
1067210667 10:44258270-44258292 CAGGGGGAGCCCCGGGGAGAGGG - Intergenic
1067431846 10:46250468-46250490 CTGTGGGAGGAGGGGGCAGATGG - Intergenic
1067441574 10:46311710-46311732 CTGTGGGAGGAGGGGGCAGATGG + Intronic
1067840954 10:49679206-49679228 CAGAAGGGGCCGGGGGAAGAAGG + Intergenic
1069646352 10:70001342-70001364 GAGTGGGAGCTGAGGGAAGGGGG - Intergenic
1069960026 10:72074005-72074027 CTCTGGGAGCTGGGGGGAGAGGG + Intronic
1070363155 10:75710598-75710620 CAGGGGAAGCGGGGGGAAAAAGG - Intronic
1071292210 10:84196001-84196023 TAGTGGGAACCCGGGGAAAAGGG + Intronic
1072188201 10:93061504-93061526 CAGTGGGAGCCGGGGGAAGAAGG - Intronic
1072785036 10:98273562-98273584 CTGGGGGTGCAGGGGGAAGAGGG - Intergenic
1073287386 10:102397063-102397085 CAGTGGGGGCCAGGCGTAGAGGG - Intronic
1073942919 10:108718562-108718584 CAGTTGGAGCAGGTGGAGGAGGG + Intergenic
1074142865 10:110690548-110690570 TAGCAGGAGCTGGGGGAAGAGGG - Intronic
1074661526 10:115663982-115664004 AAGTGGGAGCTGTGGGAAAATGG - Intronic
1075015643 10:118908445-118908467 CAGTGGGGGCTGGGGGAGGGAGG - Intergenic
1075550908 10:123391614-123391636 CAGTCTGAGTTGGGGGAAGAGGG + Intergenic
1075849503 10:125575516-125575538 CAGTGAGAGGTGGGGGAAGCAGG - Intergenic
1076014285 10:127015354-127015376 TGGTGGGAGACGGGGGCAGAGGG - Intronic
1076525930 10:131112391-131112413 CAGTGGGGGCCTGGGGGACAGGG - Intronic
1076530780 10:131142950-131142972 GAGTGGGAGCGGGAGGCAGAAGG + Intronic
1076683590 10:132187114-132187136 CAGGGGGCGCCGGGCGAAGCGGG - Intronic
1076770521 10:132660767-132660789 CAGTCAGAACTGGGGGAAGATGG + Intronic
1077999665 11:7483579-7483601 CAGTGGGTGCCGGGTGGATAAGG - Intergenic
1078731903 11:13982665-13982687 AAGAGGGAGCTGGGTGAAGAGGG + Intronic
1078987257 11:16607882-16607904 GAGGGCGGGCCGGGGGAAGAAGG + Intronic
1079089064 11:17468108-17468130 GAATGGGAGCTGGGGGAAGCAGG - Intronic
1079117960 11:17652574-17652596 CAGAGGGAGCAGTGGAAAGAAGG + Intergenic
1079298027 11:19252107-19252129 CAGTGGGAGGTCGGGGAAGGGGG - Intergenic
1079363160 11:19786693-19786715 AAGTGGGAACCTGGGGGAGAGGG + Intronic
1080521461 11:33071069-33071091 CTTTGGGAGGCGGGGGCAGACGG + Intronic
1081541394 11:44037084-44037106 CAGTGGGAGATGGGGAAAGGAGG - Intergenic
1081612740 11:44572828-44572850 AAATGGAAGCCGGTGGAAGAAGG + Intronic
1082998137 11:59268759-59268781 CAGTGGGTGCTGGGTGATGAAGG + Intergenic
1083295872 11:61715455-61715477 CAGGGGGATGGGGGGGAAGAAGG - Intronic
1083933925 11:65860646-65860668 CAGGGCGGGGCGGGGGAAGAGGG - Exonic
1084085128 11:66851474-66851496 CAGTGGCAGGCTGTGGAAGAGGG + Intronic
1084196329 11:67525109-67525131 CAGAGGGACCCTGGGGAGGAGGG - Intergenic
1084196346 11:67525151-67525173 CAGAGGGACCCTGGGGAGGAGGG - Intergenic
1084196363 11:67525194-67525216 CAGAGGGACCCTGGGGAGGAGGG - Intergenic
1084385765 11:68841850-68841872 GAGCGGGAGCCGGGGAAGGAGGG + Exonic
1084424151 11:69075432-69075454 CAGTGGGAGTTTGGGGAATAAGG + Intronic
1084596154 11:70118190-70118212 GAGGGGGAGGAGGGGGAAGAGGG - Intronic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1085031344 11:73272682-73272704 CAGTGGGGGCGGGGAGGAGATGG + Intronic
1086142232 11:83512048-83512070 CGGAGGGAGCCAGGGGAAGCTGG + Intronic
1088121873 11:106379518-106379540 AAGTGGGAGTGGGGGGAAGGGGG - Intergenic
1088520094 11:110688272-110688294 CATTGGGGGCGGGGGGAGGAGGG - Intronic
1088807442 11:113365376-113365398 GAGTGGGAGGGAGGGGAAGAAGG - Intronic
1089181181 11:116583879-116583901 CATTGGGAGTTGGGTGAAGATGG - Intergenic
1090263934 11:125342422-125342444 CACTGGGAGCTGGGGGGAGGAGG - Intronic
1090524893 11:127522405-127522427 GACTGGGAGCTGGGGAAAGAGGG + Intergenic
1090652487 11:128819561-128819583 CAGTGGGAGGGGGAGGAAGAGGG + Intergenic
1091250392 11:134139471-134139493 GATTGGAAGCCTGGGGAAGAGGG + Intronic
1092943945 12:13436027-13436049 CAGAGGGAGTGGGGGGAAAAGGG - Intergenic
1093057473 12:14568990-14569012 CAGTGGGAGAGGGGGAAGGAGGG + Intergenic
1096195916 12:49648782-49648804 CAGTGGGAGCAGGAACAAGAAGG - Intronic
1096820446 12:54229694-54229716 CACTGGCAGCCTGGGGAAAATGG - Intergenic
1096843110 12:54391039-54391061 CAGCGGCAGCCTGGGAAAGAGGG + Intronic
1097277943 12:57825869-57825891 CAGGGGGAGCATGGGCAAGAGGG + Intronic
1098901820 12:76118838-76118860 AAGTGGGAGACGGAGGAGGAGGG - Intergenic
1100221134 12:92505574-92505596 CACTGGCAGCTGGGGGAAGTGGG + Intergenic
1100857204 12:98768050-98768072 CAGTGAGAACTTGGGGAAGAGGG - Intronic
1101575568 12:105993736-105993758 CGGGGGCAGTCGGGGGAAGAGGG + Intergenic
1101616642 12:106344217-106344239 CCGTGGCAGCCAGGGGAAAATGG - Intronic
1102390344 12:112544477-112544499 CAGTGGGGGTAGGGGAAAGAGGG + Intergenic
1102572479 12:113835529-113835551 CAGTGGGGGCCGGGGTCAGTGGG + Intronic
1103239785 12:119403599-119403621 CAGAGGGCACAGGGGGAAGATGG - Intronic
1104536341 12:129621381-129621403 CAGTGGGGGCAGGGGGAGGGTGG - Intronic
1105260481 13:18775720-18775742 CAGTGGGAGTCGGGGGTGGGTGG - Intergenic
1105621596 13:22072720-22072742 CAGTGTGAGCCAGTGGAAGGAGG - Intergenic
1105683317 13:22752122-22752144 GAGAGGGAGCAGGGAGAAGATGG - Intergenic
1106481910 13:30143232-30143254 CAGATGGAGCCGGGGCAGGAGGG - Intergenic
1107307434 13:39037902-39037924 CACCAGGAGCCGGGCGAAGAGGG + Exonic
1107628786 13:42320511-42320533 CAGTGGGAGGAGGGGGGAGGGGG - Exonic
1108026089 13:46179556-46179578 TAGTGGGGGCAGGGAGAAGATGG + Intronic
1110298150 13:73894051-73894073 TAGTGAGAGACAGGGGAAGATGG + Intronic
1110812876 13:79829889-79829911 AAGTGGGAGTCTGGGAAAGATGG - Intergenic
1112379953 13:98879254-98879276 CAGTGGGAACCAGGGGAAGCAGG + Intronic
1113339918 13:109412432-109412454 CAGTGTGAGGGAGGGGAAGAGGG - Intergenic
1113517463 13:110914661-110914683 CAGTGGGAGTCGGGGAAAGCGGG - Intronic
1113645956 13:111996232-111996254 CTGTGGGAGCCGGGGGAGTGGGG - Intergenic
1115709960 14:36039746-36039768 TAGGGGAAGCCGGGGGAAGAAGG + Intergenic
1117107135 14:52409450-52409472 AATTGGGAGACGGGGGTAGAGGG - Intergenic
1118128674 14:62937842-62937864 CAGTGTGTGCCTGGGGAGGAGGG + Intronic
1118253439 14:64183932-64183954 CAGAGGGAGACGTGGAAAGAAGG + Intronic
1118780529 14:69004842-69004864 CAGGGAGAGCTGGGGGAAGAGGG - Intergenic
1118973151 14:70654242-70654264 CAGAGAGAGCTGGGGGATGAGGG - Intronic
1119163991 14:72477123-72477145 CTGTGGGAGCTGGAGGAAGGAGG + Intronic
1119178296 14:72586083-72586105 CAGTGGGAGCCAGGCCATGAAGG - Intergenic
1121599385 14:95191805-95191827 GAGTGGGGGCCGGGGAGAGACGG - Intronic
1122325605 14:100879394-100879416 CAGTGGGAGGCGGGGGAGTGGGG - Intergenic
1122455143 14:101844416-101844438 CAGGGGCAGCCGGGGGATCAGGG - Intronic
1122564928 14:102646844-102646866 CAGTGGGAGAGGGAGGGAGAAGG + Intronic
1122697294 14:103562364-103562386 CGGGGGAAGCCGGGGGAGGAGGG + Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1202835858 14_GL000009v2_random:76951-76973 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1123402527 15:20002802-20002824 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1123511865 15:21009456-21009478 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1123992891 15:25696489-25696511 CAGTGGGAGCAACGGGATGAAGG - Intronic
1124114385 15:26827646-26827668 CAGTGTGAGCTGGGGCAGGAGGG - Intronic
1125943770 15:43696839-43696861 CAGAGGGAGACTGGGGAAGGTGG + Intronic
1126158478 15:45587153-45587175 TGGTGGGAGCTGGGGGAGGACGG - Exonic
1126159541 15:45597231-45597253 CTTTGGGAGCCTGGGGCAGAAGG + Intronic
1126697668 15:51340026-51340048 TGGTGGGAGCAGGAGGAAGAGGG + Intergenic
1127320000 15:57834690-57834712 GAGTGGGGGCGGGGGGAAGCTGG + Intergenic
1127485346 15:59413174-59413196 CTGTGGGAGATGGGGGAACATGG + Intronic
1127842980 15:62846523-62846545 GAGAGGGAGCTGGGGGCAGACGG + Intergenic
1128143988 15:65322182-65322204 GAGAGGGAGCAGGGAGAAGAAGG - Intergenic
1128248503 15:66149089-66149111 GAGTGGGAGCCAGGGGCAAAGGG - Intronic
1128344382 15:66844301-66844323 GAGGGGAAGCCTGGGGAAGAGGG - Intergenic
1128347036 15:66860862-66860884 CACTGGCAGCCTGGGGAAGGAGG + Intergenic
1128648325 15:69393079-69393101 AAGTGGGAGCTGAGGGGAGAGGG + Intronic
1129644565 15:77419193-77419215 CAGAGGCAGGCGGGGGAGGAGGG + Intronic
1130742448 15:86615392-86615414 CAGTGGGATCTGGGGTAAGGAGG + Intronic
1130957896 15:88639902-88639924 CAGTGGCAGCCTGGGGTAGAGGG - Intronic
1130958015 15:88640718-88640740 CGGTGGGAGGCGGAGGCAGATGG + Intronic
1131144389 15:90001843-90001865 GAGGGAGAGCCGGGGAAAGAGGG + Intronic
1131182429 15:90249706-90249728 GACCTGGAGCCGGGGGAAGAGGG + Exonic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1132390808 15:101436963-101436985 CTGTGGGATCCAGGGCAAGATGG - Intronic
1132623634 16:879816-879838 CAGTAGGAGCCGGGGTCAGGGGG - Intronic
1132629610 16:910823-910845 CAGAGGGCGGCGGGGGAGGAAGG + Intronic
1133023583 16:2977732-2977754 CAGTGCTAGGCGGGGGGAGAGGG - Intronic
1133106545 16:3513932-3513954 AAGTGGAAGTCTGGGGAAGAGGG + Intronic
1133423999 16:5671846-5671868 CAGTGTGAGCTGGGGGTTGAAGG + Intergenic
1133605644 16:7385248-7385270 CAGTGGGGCCCAGGAGAAGAAGG + Intronic
1133747201 16:8696279-8696301 CAGGGGGACCCTGGGGAAGAAGG + Intronic
1134005693 16:10817915-10817937 CATTGGGAGAGGGAGGAAGAAGG - Intronic
1134507276 16:14818490-14818512 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134694977 16:16217248-16217270 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134976854 16:18577404-18577426 CAGTGGGAGTTTAGGGAAGATGG + Intergenic
1135205071 16:20476689-20476711 CAGTGGGTGGCGGGAAAAGATGG + Intronic
1135213827 16:20547124-20547146 CAGTGGGTGGCGGGAAAAGATGG - Intronic
1135615553 16:23908118-23908140 CCCTGGGAGCTGGGGGAAGGAGG + Intronic
1135695328 16:24581361-24581383 CGGTGGGGGGAGGGGGAAGATGG - Intergenic
1136006155 16:27330717-27330739 CAGTGGGTGCCAGGGGCTGAGGG - Intronic
1136153727 16:28368380-28368402 CGGTGGGAGCAGCGGGAAGCCGG - Intergenic
1136209365 16:28746890-28746912 CGGTGGGAGCAGCGGGAAGCCGG + Intergenic
1136294321 16:29293052-29293074 CAGTGTGAGCCGCAGGGAGAAGG - Intergenic
1136736866 16:32474340-32474362 CAGTGGGAGCCGGGGCCCTAGGG + Intergenic
1137575513 16:49597243-49597265 CAGTGGGAACCTGGGGGAGGAGG + Intronic
1137719129 16:50617487-50617509 CAAAGGGAGCCGGGTGAAGATGG + Intronic
1137978878 16:53053436-53053458 GAGTGGGGGCCGGGGGGAGGGGG + Intergenic
1138130212 16:54472894-54472916 TAGTGGGAGGCAGGGGAAGTGGG + Intergenic
1138353201 16:56357688-56357710 CACCGGGAGCCGGGAGGAGAGGG - Intergenic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1140333074 16:74076533-74076555 CAGTGGGAGGGAGGGAAAGAAGG - Intergenic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1141210172 16:81972379-81972401 AAGTGGGGGGAGGGGGAAGAAGG - Intergenic
1141675916 16:85517240-85517262 CTGTGGGAGGCGGGAGGAGATGG + Intergenic
1141891769 16:86930911-86930933 GAGGGGGAGGAGGGGGAAGAAGG - Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1142100227 16:88267099-88267121 CAGTGTGAGCCGCAGGGAGAAGG - Intergenic
1142225775 16:88877010-88877032 CTGGGGGAGCCGGGGCGAGAAGG + Exonic
1203016203 16_KI270728v1_random:355237-355259 CAGTGGGAGCCGGGGCCCTAGGG - Intergenic
1203034538 16_KI270728v1_random:628395-628417 CAGTGGGAGCCGGGGCCCTAGGG - Intergenic
1142707864 17:1708022-1708044 CAGCGGGACCAGGCGGAAGAGGG + Exonic
1142718660 17:1762293-1762315 CAGAGGGAGCTGGGGGGACAAGG + Intronic
1143134523 17:4704108-4704130 CACTGGAACCCGGGGGAAGATGG - Exonic
1143478405 17:7215861-7215883 AAGTGGGGGCCGGGGGAGGCGGG - Intronic
1143584586 17:7844844-7844866 CAGCGGTGGCCGGGGGAGGAGGG - Intronic
1143594565 17:7906581-7906603 CTGTGTGAGCCTGGGGCAGACGG + Exonic
1143646761 17:8235238-8235260 CAGTGGGAGGGGGGACAAGAAGG - Exonic
1144048193 17:11472099-11472121 CAGTGGTTGCCAGGGGAAAACGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144848253 17:18231181-18231203 CAGTGGCAGTCAGGGGAAAAAGG - Intronic
1144962267 17:19051589-19051611 CACTGGGAGCTGGGGGCAGAGGG - Intergenic
1144972894 17:19122931-19122953 CACTGGGAGCTGGGGGCAGAGGG + Intergenic
1145031405 17:19507630-19507652 CAGGGGGACCCCGGGGTAGAAGG - Intronic
1145238466 17:21225453-21225475 CGGTGGGAGTCGGGGGCAGTGGG + Intergenic
1145791891 17:27632528-27632550 CAGAGGGGGCTGGGGGAAGCTGG + Intronic
1145813857 17:27781542-27781564 CTGGGAGAGCAGGGGGAAGATGG - Intronic
1145912890 17:28552606-28552628 CGGCTGGAGCCGGGGGAAGTGGG + Exonic
1146268080 17:31466220-31466242 CAGTGGGTCCCAGGGGAAGGAGG + Intronic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1147109571 17:38251993-38252015 CTGTGGGAGGCCGAGGAAGATGG + Intergenic
1147128540 17:38391286-38391308 TAGTGGGAGCAGGGGTGAGAGGG - Intronic
1147155640 17:38543360-38543382 CAGGCGGAGCCCTGGGAAGAGGG + Intronic
1147161637 17:38572379-38572401 CTGTGGGACGCTGGGGAAGAGGG + Intronic
1147948114 17:44091935-44091957 CAGTGGGAGCTCAGGGTAGAGGG - Intronic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1148350397 17:46937597-46937619 CAGTGGCTGCCTGGGGCAGAGGG - Intronic
1148503182 17:48107446-48107468 CAGTGGGTCCCGGGAGCAGAGGG - Intronic
1150505898 17:65698880-65698902 CAGTGCAAGCCCAGGGAAGAGGG + Intronic
1150689590 17:67353302-67353324 GAGAGGGAGCGGGGGGAAGGAGG - Intronic
1151301694 17:73231944-73231966 CACTGCGGGCCGGGGGAGGAGGG - Intronic
1151320301 17:73348798-73348820 CAGTGGGGGCCTGGGGAACACGG + Intronic
1151683840 17:75635565-75635587 CAGTTGGAGCCAGGGCAAAAAGG + Intronic
1152811832 17:82386053-82386075 CACTGGAGGCCAGGGGAAGACGG - Intergenic
1152811894 17:82386263-82386285 CACTGGAGGCCAGGGGAAGACGG - Intergenic
1154318373 18:13324521-13324543 CAGTGGCAGAACGGGGAAGAGGG + Intronic
1154425536 18:14269075-14269097 CAGTGGGAGTCGGGGGTGGGGGG + Intergenic
1154428268 18:14288661-14288683 CAGTGGGAGCTGGGGGTGGGGGG + Intergenic
1155036579 18:22029818-22029840 CAGTGAGAGCCGAGAGAAGGGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156791755 18:40984096-40984118 CAGGGGGAGGAGGAGGAAGAGGG - Intergenic
1157455728 18:47827467-47827489 AAGTGGGAGACGGGGGGAGACGG - Exonic
1158388905 18:57027094-57027116 TTGTGGGAGCCGGGGGACGCGGG - Exonic
1158633569 18:59137140-59137162 CAGTGGTTGCCGGGGGTAGGGGG - Intergenic
1158813658 18:61068338-61068360 AAGGGGGAGCCCAGGGAAGAAGG - Intergenic
1158839194 18:61365308-61365330 CAGTGGGACCCGACAGAAGATGG - Intronic
1159831637 18:73284684-73284706 GCGTGGGAGCCGGGGTAAGATGG + Intergenic
1159867166 18:73719834-73719856 GAGTTGGTGCAGGGGGAAGAAGG - Intergenic
1160191878 18:76721506-76721528 CAGTAGGGGCAGGGGGAAGATGG + Intergenic
1160265290 18:77336503-77336525 CAGTGGGAGGAGGTGGAAGGGGG + Intergenic
1160357198 18:78238705-78238727 CAGTGGGAGCCGCGGGCAGGCGG + Intergenic
1160430024 18:78804642-78804664 CAATGGCAGCCAGGGGCAGAGGG + Intergenic
1160588195 18:79924406-79924428 CCGTCGGGGCTGGGGGAAGACGG + Intronic
1160840543 19:1145132-1145154 GACTAGGAGCAGGGGGAAGAGGG + Intronic
1161012773 19:1968307-1968329 CAGGGGCAGCCTGGGGAGGAGGG - Intronic
1161290295 19:3490516-3490538 CAACAGGAGCTGGGGGAAGACGG + Intergenic
1162330155 19:10023172-10023194 CAGTGGGCGCCAGGGGCTGAGGG + Intergenic
1162414774 19:10528902-10528924 CTTTGGGAGCCTGGGGAAGGTGG - Intergenic
1163228176 19:15979628-15979650 CAGTGGGAGGCAGGGGATCAGGG - Intergenic
1163248357 19:16111277-16111299 CAGTGGGGGCCTAGGGAGGAAGG - Intergenic
1163575025 19:18105859-18105881 CAGTGGGGGCGTGGGGAGGACGG - Intronic
1163795491 19:19335496-19335518 CAGTGGGTGCCTGGGCAGGAGGG - Intronic
1164476087 19:28576987-28577009 CAGTAGGTGCCTGGGAAAGAAGG + Intergenic
1164530851 19:29047163-29047185 CTTTGGGAGCCTGAGGAAGAAGG - Intergenic
1164823495 19:31267536-31267558 GAGTGGGGGCAGGGGAAAGAAGG - Intergenic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165245589 19:34496718-34496740 GAGTGAGGGCAGGGGGAAGAGGG + Intronic
1165787270 19:38469235-38469257 CAGAGGGAGCCGAGGGGAGGAGG - Intronic
1165949255 19:39464772-39464794 CAGGGTGAGCCGGTGGAAGGAGG - Intronic
1166048995 19:40246984-40247006 CAGTGGGAGCCAGGGTAGGTGGG - Intronic
1166326857 19:42056394-42056416 CACAGGAAGCAGGGGGAAGAGGG + Intronic
1166562826 19:43744707-43744729 CACTGGGAGCAGGGGCAAGGTGG - Intronic
1166584620 19:43934954-43934976 CTGTGGGAGGTGGGGGAAGGCGG + Exonic
1167072815 19:47230631-47230653 CAGTGCGGCCCCGGGGAAGAGGG - Intronic
1167360856 19:49029711-49029733 CAGAGGGAGCCTGGGGGAGCGGG - Intronic
1167365151 19:49050824-49050846 CAGAGGGAGCCTGGGGGAGCGGG + Intergenic
1167578621 19:50329400-50329422 CACTGGTAGCCAGGGGAAGGCGG + Intronic
1168267475 19:55230610-55230632 CACTGGGAGCCTGGGGATGCAGG + Exonic
1168517069 19:57017533-57017555 CAGAGGGAGAAGGGGGATGAGGG - Intergenic
1202636779 1_KI270706v1_random:50412-50434 AAGTGGGACCTGGGAGAAGAGGG + Intergenic
925084515 2:1097461-1097483 CAGAGGCAGCCTGGGGTAGACGG - Intronic
925157525 2:1658832-1658854 CAGAGGGAGCCGCGGGGAGATGG - Intronic
925744452 2:7032613-7032635 AAGAGGCAGCCGGAGGAAGACGG - Intronic
927775356 2:25898754-25898776 CACTGGGGACCTGGGGAAGAGGG + Intergenic
928606461 2:32947964-32947986 CTCTGGGCGCCGCGGGAAGAGGG + Intronic
929285299 2:40128961-40128983 CAGTGGTTGCCTGGGGCAGAGGG + Intronic
929791205 2:45024386-45024408 CAGTGGTAGCCAGGGCAAGAGGG + Intergenic
930136154 2:47905807-47905829 GAGTGGGAGAGGGGGGAGGAAGG + Intergenic
930771455 2:55134320-55134342 CAGGAGGAGTGGGGGGAAGAGGG - Intergenic
932573036 2:72947861-72947883 CAGTGGCAGCGTGGGGACGAGGG - Intronic
934651329 2:96092735-96092757 CTGTGGCGGCCGGGGGAAGGTGG + Intergenic
935650262 2:105375821-105375843 CACTGGGAGTTGGGGGCAGAGGG + Intronic
935901880 2:107801696-107801718 CAGCGGGAGCCAGGTGAAGATGG - Intergenic
935949544 2:108316343-108316365 GAGTGGGAGAGGTGGGAAGAAGG - Intergenic
936479322 2:112870518-112870540 CAATGGGGGCCAGGGGATGATGG - Intergenic
937221064 2:120343630-120343652 CGGTGGGAGGCGGGGGCAGGAGG + Intergenic
937269410 2:120638581-120638603 CAGCGGGAGCCGGAAGAAGTGGG + Intergenic
937333057 2:121044155-121044177 CTCTGGGAGCCTGGGAAAGAGGG + Intergenic
937921802 2:127136547-127136569 GGGTGGGAGACGGGGGAAGACGG + Intergenic
938341040 2:130536796-130536818 AAGTAGGAGCCGTGGGGAGAGGG - Intergenic
938348790 2:130583913-130583935 AAGTAGGAGCCGTGGGGAGAGGG + Intronic
938794344 2:134705591-134705613 CAGAGGAAGCCGGGGTAGGAAGG - Intronic
938944127 2:136195582-136195604 CAAAGTGAGCTGGGGGAAGATGG - Intergenic
942565758 2:177264165-177264187 CGGTGGGCGGCGGGGCAAGAGGG - Intronic
943050756 2:182910455-182910477 CAGTTGGAGCCTTGGGAACAAGG + Intronic
945505710 2:210637856-210637878 CAGTGGGGGATGGGGGAAAAGGG - Intronic
945972986 2:216248334-216248356 TAGTGGGAGACGGGGAAAGTGGG - Intergenic
946037682 2:216756702-216756724 CAGGGGGAGCTGCCGGAAGAAGG + Intergenic
946370576 2:219279291-219279313 CAGGGGCTGCCGGGAGAAGAGGG - Exonic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
948075939 2:235165266-235165288 CAGTGGGAGTGGTGGAAAGAAGG - Intergenic
948143583 2:235692299-235692321 CACTGGCACCCTGGGGAAGATGG - Intronic
948266309 2:236637682-236637704 GTGTGGGGGCAGGGGGAAGATGG - Intergenic
949059685 2:241949604-241949626 CAGAGGGAGCCAGGGGAGGCAGG + Intergenic
1168833989 20:864779-864801 CAGTGGGATCCTGGGAAAGGTGG + Intergenic
1169000333 20:2163631-2163653 CAGAGGAAGCAAGGGGAAGAAGG + Intronic
1169073612 20:2748965-2748987 CAGTGCAGGGCGGGGGAAGAAGG + Intronic
1169358223 20:4925618-4925640 CGGTGGGTGCCGGGGCAGGAAGG - Intronic
1169464624 20:5826815-5826837 CTGTGAAAGCCTGGGGAAGAGGG + Intronic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171059526 20:21942977-21942999 CAGTGCTAGCCAGGGGAAGCAGG + Intergenic
1171365165 20:24618053-24618075 CAGGAAGAGCCGGGGGAAGAGGG + Intronic
1171880892 20:30616828-30616850 AAGTGGGACCTGGGAGAAGAGGG + Intergenic
1172038743 20:32029044-32029066 CAGTGGGAGCCATGGAAAGAAGG - Exonic
1172093560 20:32449776-32449798 CAGAGGGATGCGGGGGAAGAGGG + Intronic
1172101056 20:32484034-32484056 CGGTGGGGGCTGGGGGGAGAGGG + Intronic
1172429314 20:34876678-34876700 CAGCGGGAGCCGGGGCCAGGAGG + Exonic
1172603262 20:36197988-36198010 GAGGGGGAGGCGGGGGAGGAGGG - Exonic
1172912456 20:38420101-38420123 CAGTGGGAGTAGGGTGAACATGG - Intergenic
1173249035 20:41354892-41354914 CAGGGGGAGCCTGGGAAAGATGG + Intronic
1173619514 20:44426067-44426089 CTGTGGAATCAGGGGGAAGATGG + Intronic
1173976861 20:47193629-47193651 CATTGGGAGCCGGAGGCAGAAGG + Intergenic
1174592736 20:51658981-51659003 CAGAGGGAACGGGAGGAAGATGG - Intronic
1175889678 20:62310635-62310657 GAGTGGGGGCTGGGGCAAGATGG + Intronic
1175908472 20:62393305-62393327 CAGATGGAGCCTGGGGAACAGGG - Intronic
1176219453 20:63963159-63963181 CAGTGGGTGCAGGGGAAGGAGGG + Exonic
1176221904 20:63973751-63973773 CAGTGGCTGCCGGGGGAACTCGG - Intronic
1176940168 21:14913559-14913581 CAGTGGGAGGTGGAGCAAGATGG - Intergenic
1177238488 21:18424656-18424678 CAAAAGGAGCCGGGGGAAAAAGG + Intronic
1177736209 21:25092930-25092952 GAGCAGGAGCCGGGGGAAGAGGG - Intergenic
1178246902 21:30961617-30961639 CATTGGGAGATGAGGGAAGAAGG - Intergenic
1178584408 21:33860382-33860404 CAGTGGGGGCTGGGGGAGGCGGG + Intronic
1178908030 21:36652302-36652324 GGGTGGGAGCCTGGGGGAGATGG - Intergenic
1179357788 21:40677393-40677415 AAGTGGGAGCCGGGGGGTGAGGG + Intronic
1179793238 21:43767801-43767823 AAGCCGGAGACGGGGGAAGAAGG - Intergenic
1179833533 21:44012793-44012815 CAGTTGGAGCCGGTGGAACCCGG + Intronic
1179965278 21:44801363-44801385 CAGTGAGAGCTTGAGGAAGAAGG - Intronic
1180304720 22:11065348-11065370 CAGTGGGAGAAGGGTAAAGAGGG - Intergenic
1180364092 22:11923901-11923923 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1180535682 22:16391572-16391594 CAGTGGGAGCCGGGGCCCCAGGG - Intergenic
1181462795 22:23095264-23095286 CAGTGGGAGCCGGAGGCGGGGGG + Exonic
1181953771 22:26573507-26573529 CAGCTGGGGCCAGGGGAAGAGGG - Intronic
1182021891 22:27088648-27088670 CATTGGGAACTTGGGGAAGAGGG + Intergenic
1182155904 22:28072769-28072791 CAGAGGTAGCAGGGGGAAGCCGG + Intronic
1182437131 22:30337835-30337857 CATTGGGGGCCGGGGCATGACGG + Exonic
1182866103 22:33606029-33606051 GAGTGGGGGCCGGGGGCGGAGGG + Intronic
1183492955 22:38126555-38126577 CAGGGGGAGTGGGGGGATGAGGG - Intronic
1183722922 22:39572717-39572739 CAGGGAGTGCCCGGGGAAGAGGG + Intronic
1184059387 22:42073065-42073087 CAGTAGGAGGTGGGGGTAGAAGG - Intergenic
1184128536 22:42503537-42503559 CAGTGGCAGGCAGTGGAAGAGGG + Intergenic
1184137330 22:42556852-42556874 CAGTGGCAGGCAGTGGAAGAGGG + Intronic
1184307580 22:43616914-43616936 CAGCGGGAGTCAGGTGAAGAAGG - Intronic
1184327182 22:43797816-43797838 CAGAGGGAGCCGGGGGAGGATGG - Intronic
1184530356 22:45051575-45051597 CAGTGGGAGCCGGGGGCCACGGG - Intergenic
1185088520 22:48753416-48753438 CAGTGGGGGCCCTGGGCAGAGGG - Intronic
1185323100 22:50210848-50210870 CAGGTGGAGCTGGAGGAAGACGG + Exonic
1185372547 22:50467702-50467724 CAGGGGGAGACGGGGGCAGGGGG + Intronic
949368641 3:3310460-3310482 CAGTGTGAGCTGGAGGCAGAGGG - Intergenic
949802456 3:7918548-7918570 TTTTGGGAGCTGGGGGAAGAAGG - Intergenic
949857287 3:8473271-8473293 CTGCGGGAGCCAGGAGAAGATGG - Intergenic
950153196 3:10704045-10704067 CAGAGGGAGTGAGGGGAAGATGG - Intronic
950903595 3:16517779-16517801 CAGTGGGGGCGGGGGAATGATGG - Intergenic
951034793 3:17921227-17921249 AAGAGGGAGCCATGGGAAGATGG + Intronic
952621000 3:35342389-35342411 AAGTGGGGGAGGGGGGAAGAAGG + Intergenic
955219436 3:57011560-57011582 CTGTGGGTGGCGGGGGAAGGTGG - Intronic
955613639 3:60783179-60783201 CAGTGAGAGCCTGGGCAACATGG - Intronic
956939861 3:74145733-74145755 CAGTGAGACCCGGGGAGAGAGGG + Intergenic
957997280 3:87706482-87706504 GAGTGGGAGATGTGGGAAGATGG - Intergenic
958916900 3:100060045-100060067 AAATGGGGGCGGGGGGAAGATGG + Intronic
960082955 3:113560490-113560512 GAGTGGGAGCATGGGAAAGATGG + Intronic
960618701 3:119619211-119619233 CAGTGGGAGCATGGTGAAGCAGG - Intronic
961324273 3:126101089-126101111 CACTTGGACCCGGGGGAAGGAGG - Intronic
961514642 3:127425048-127425070 CAGTGGGAGGCTGAGGGAGAGGG + Intergenic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
961973123 3:130991214-130991236 TAGTGGAAGCCAAGGGAAGATGG + Intronic
962426254 3:135271559-135271581 CAGAGGGAGTTGGGGGCAGAAGG + Intergenic
962907151 3:139814333-139814355 CAGTGGGAGGTGGGGCAATAAGG + Intergenic
963015198 3:140817269-140817291 CAGTGGGGGCAGGGGGCATATGG + Intergenic
963239296 3:142987082-142987104 CAGGGGGAGCCGGGGGGAGGCGG + Intronic
964282309 3:155079979-155080001 CAGTGGGATTCGGGAGAAGTTGG - Intronic
964382966 3:156116291-156116313 CATTGGGAGTCAAGGGAAGAAGG - Intronic
964720586 3:159764650-159764672 GAGTGGGCGCCGGAGGAGGACGG + Exonic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
967214913 3:187201568-187201590 CAGTGGGGTCAGGGGGCAGAAGG - Intergenic
967805999 3:193715095-193715117 CTGGTGGAGCTGGGGGAAGAGGG + Intergenic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968958370 4:3730461-3730483 CAGTGGGGGCTGGGGGCACAGGG + Intergenic
969258659 4:6020331-6020353 CAGTTGGAGGCGGGGGATGGGGG + Intergenic
969474617 4:7414423-7414445 CAGTGGGAGCCGCGGGGCAATGG + Intronic
969658333 4:8510648-8510670 CAGGGGGTGTCAGGGGAAGAGGG + Intergenic
969884907 4:10206697-10206719 CAGTGTGAGGTGGGGGATGACGG + Intergenic
969948620 4:10810632-10810654 CTTTGGGAGGCGGGGGCAGATGG - Intergenic
970999307 4:22304165-22304187 CTGAGGGAGCTGTGGGAAGAGGG + Intergenic
972287458 4:37662773-37662795 AGGTGGGAGGTGGGGGAAGATGG - Intronic
972916452 4:43886496-43886518 CAGTGGTTGCCGGGGGTTGAAGG - Intergenic
973072987 4:45888434-45888456 CAGTGGGAGCAGTGTTAAGAGGG - Intergenic
973764288 4:54149431-54149453 TCGGGGGAGCCGGGGGAGGAAGG + Intronic
974047335 4:56908585-56908607 CGGTGGGACCCGGGGGCAGGAGG - Intronic
975321191 4:73011594-73011616 CAGTGGGAGCCAGGGACAAATGG + Intergenic
975615483 4:76242324-76242346 CAGTGGGAGCAAGAGAAAGAGGG - Intronic
975910126 4:79258078-79258100 CAGTGGGAGCCAGGGAAAAGTGG + Intronic
975973899 4:80073232-80073254 CAGTGTGCGCCTGGGGACGAGGG + Intronic
976072357 4:81256383-81256405 CAGTGTGAGTCGGGGGCACATGG - Intergenic
976517609 4:85986931-85986953 CAGTGGGAGCTCAGGGAGGAAGG + Intronic
976938200 4:90665897-90665919 CAGTGGGAGGTGTGGGAAAAGGG + Intronic
977296580 4:95216364-95216386 CAGAGGGAGCCGTGGTAAGGAGG - Intronic
977647895 4:99435018-99435040 CAGTGGAAGCAGGGGTAAGTTGG - Exonic
979529591 4:121755031-121755053 CAGTTGGAGGTGGGGGATGAGGG + Intergenic
981602210 4:146502843-146502865 CAGTGGTTGCCTGGGGAAGAGGG + Intronic
984812366 4:183806659-183806681 AAGTGGGGGTCGGGGGAAGAAGG - Intergenic
985774116 5:1831784-1831806 GAGGAGGAGCCGGGGGAAGGGGG - Intergenic
988153756 5:27422139-27422161 CAGAGGGAGCTGGAGGAAAATGG - Intergenic
989020336 5:36998042-36998064 CACTGGGTGCCTGGGGAAAATGG + Intronic
990238719 5:53795686-53795708 CAGATGGAGCAGGGAGAAGATGG - Intergenic
992299376 5:75362948-75362970 CACTGGAAGCCGAGAGAAGATGG + Intergenic
993058371 5:83009168-83009190 CAGTGGGAGACGGAGGAACTTGG - Intergenic
993442794 5:87977637-87977659 TAGTGGGAGCAGGAGGAAGGGGG - Intergenic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
994985538 5:106928433-106928455 CAGAAAGAGCTGGGGGAAGATGG + Intergenic
995742873 5:115373587-115373609 AGTTGGGAGTCGGGGGAAGAAGG - Intergenic
996810347 5:127510024-127510046 CAGTGGGTGCCTGGGAAATATGG + Intergenic
997266342 5:132497175-132497197 CAGCGGGAGCCGGGGAAAACCGG + Intergenic
997496036 5:134327042-134327064 AACTGGGAGCTGGAGGAAGAGGG - Intronic
998178413 5:139916561-139916583 CAGTGGTTGCCAGGGGATGAAGG - Intronic
998401228 5:141850072-141850094 CTGCGGGCGCCCGGGGAAGAAGG + Intergenic
998410024 5:141902825-141902847 CTGGGGGAGCCAGGGGAAGTAGG + Intergenic
998885213 5:146686898-146686920 CAGCGGGAGGTTGGGGAAGAAGG + Intronic
999136708 5:149325320-149325342 GACTGGCAGCTGGGGGAAGAAGG - Intronic
999226654 5:150030904-150030926 CAGTAGGAGGCTGGGGGAGAGGG + Intronic
999721515 5:154402232-154402254 CAGAGGGAGAAAGGGGAAGAGGG - Intronic
1000046396 5:157525332-157525354 AGGTGGGAGCCTGGGGCAGAAGG - Intronic
1001044182 5:168358913-168358935 CAGTGGTTGCCTGGGGAGGAGGG - Intronic
1001079997 5:168660696-168660718 CAGGGAGACCTGGGGGAAGAAGG + Intergenic
1002336999 5:178486652-178486674 CAGGGAGAGCCGGGTGAAAAAGG + Intronic
1002458211 5:179358051-179358073 CAGTGGGAGTGGGGTGAGGAGGG + Intergenic
1002531167 5:179846522-179846544 CACTGGGAGGCCGGGGCAGATGG - Intronic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1003261532 6:4521133-4521155 CTGAGGGAGCCGAGGGAAGTGGG - Intergenic
1003285667 6:4731889-4731911 CTGTGGAAGGAGGGGGAAGATGG + Intronic
1003421092 6:5959193-5959215 CAGTGGGTGGCGGGGGAGGGGGG + Intergenic
1003926646 6:10883011-10883033 AGGTGGGAGCCTGGGGAAGGAGG + Intronic
1004093691 6:12531388-12531410 CAGTGGGTGCCAGGGGTACAGGG + Intergenic
1005989222 6:30892920-30892942 CAGTGGGGGCTGGGGGAGCAGGG - Intronic
1006316131 6:33293038-33293060 CAGATGGAGTTGGGGGAAGATGG - Exonic
1006458143 6:34143654-34143676 CATTGGGATCCGGGGGAAAGTGG + Intronic
1006770206 6:36547001-36547023 CATCTGGAGACGGGGGAAGAAGG + Intronic
1008174242 6:48247092-48247114 TAGTGGGAGGTGGGGGGAGAAGG + Intergenic
1009602627 6:65821854-65821876 TAGTGGGAGTGGGGGGAAGTGGG + Intergenic
1011394435 6:86891462-86891484 GGGTGGGGGCTGGGGGAAGAGGG + Intergenic
1011582192 6:88881298-88881320 AAGTGGGGGCAGGGGGCAGAGGG + Intronic
1011643730 6:89437992-89438014 CAGTGTGAGCCTGGGCAACAAGG - Intronic
1012487270 6:99736387-99736409 CAGCAGGAGCTGGGGTAAGATGG - Intergenic
1013987078 6:116207745-116207767 CAGTGGGAACCTGGGCACGAGGG - Intronic
1014165191 6:118216442-118216464 AAGTGGGGGTAGGGGGAAGAAGG - Intronic
1017451679 6:154560050-154560072 CAGTGGGGGCCGGGGGGTGAGGG - Intergenic
1018784732 6:167099117-167099139 CAATGGGAGCAAGAGGAAGAAGG + Intergenic
1018838288 6:167501247-167501269 CAGTGCCAGCTGGGGCAAGAGGG - Intergenic
1018908878 6:168090506-168090528 CAGTGAGAACAGGGAGAAGATGG - Intergenic
1018945788 6:168346012-168346034 CCGGGGCAGCCGGGGGAAGCCGG + Intergenic
1019379508 7:713434-713456 GAGTGGGAGACAGGTGAAGATGG - Intronic
1019591875 7:1839740-1839762 CCCTGGGAGCCGGGGGGAGGCGG - Intronic
1019740478 7:2670482-2670504 GAGTGGGGGCCTGGGGGAGAGGG + Intergenic
1021634818 7:22681949-22681971 CAGTGGGGGTGGGGGTAAGAAGG - Intergenic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1022132452 7:27416900-27416922 CAGTCGGAGACTGGGGTAGAGGG - Intergenic
1022363514 7:29685609-29685631 CCGTGGGAGCCGGAGGATGGCGG - Intergenic
1022427775 7:30284916-30284938 CCGTGGGAGCCGGAGGATGGCGG + Exonic
1022697859 7:32728135-32728157 CCGTGGGAGCCGGAGGATGGCGG + Intergenic
1023465201 7:40447105-40447127 CAGTGGAAGCTGGGGGAAGATGG - Intronic
1023864988 7:44234300-44234322 CAGAGGGGGCCGGGTGAAGGTGG - Intronic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1027128793 7:75576016-75576038 CAGTTGGAGCCTGAGGAAGCCGG - Intronic
1028267817 7:88749458-88749480 CAGTAGTACCCCGGGGAAGAGGG + Intergenic
1028607512 7:92671292-92671314 AAGTGGTAGCCTGGGGTAGATGG + Intronic
1028965980 7:96801661-96801683 CAGTATGAGCTGGGGGAAGGGGG + Intergenic
1029104387 7:98163602-98163624 CGGTGGGAGCCCGGAGAAGCTGG - Intronic
1029419131 7:100463316-100463338 CACTGGGGGCTGGGGAAAGAGGG + Intronic
1030205138 7:106945102-106945124 AAGTGGGAGTTGGGGGAAGGAGG - Intergenic
1031643246 7:124191018-124191040 CAGAGGGGGCAGGGGGATGATGG - Intergenic
1032284141 7:130528180-130528202 CCGTGGGATGTGGGGGAAGAGGG + Intronic
1032354182 7:131194284-131194306 CAGGGGCTGCCGGGGGAAGTTGG - Intronic
1032550144 7:132777330-132777352 CACTGGGAAGCTGGGGAAGAGGG - Intergenic
1033390475 7:140923813-140923835 AAGTGGGAGCTGGGGTTAGAAGG + Intronic
1034465160 7:151223691-151223713 CAGTGGGGGCTGGAGGATGAGGG - Exonic
1034938487 7:155214825-155214847 GAGTGGGAGCCGGAGGACGGCGG + Intergenic
1035385620 7:158470702-158470724 CAGTGGGAGGTGAGGCAAGAGGG + Intronic
1035783610 8:2247224-2247246 GAGGAGGAGCCAGGGGAAGATGG + Intergenic
1035784031 8:2248515-2248537 GAGGAGGAGCCGGGGGAAGCTGG + Intergenic
1035784069 8:2248629-2248651 GAGGAGGAGCCGGGGGAAGCTGG + Intergenic
1035784278 8:2249275-2249297 GAGGAGGAGCCAGGGGAAGATGG + Intergenic
1035808492 8:2472286-2472308 CAGGAGGAACCAGGGGAAGATGG - Intergenic
1035808514 8:2472362-2472384 GAGGAGGAGCCAGGGGAAGATGG - Intergenic
1035827740 8:2662316-2662338 CAGTGGGAGACAGAGGAAGAGGG - Intergenic
1036660093 8:10702297-10702319 CAGTGGGGGCTGAGGGAGGAGGG - Intronic
1037703491 8:21295988-21296010 GAGTGAGAGCTGGGGGGAGAGGG - Intergenic
1037703498 8:21296012-21296034 GAGTGAGAGCTGGGGGGAGAGGG - Intergenic
1038133070 8:24755467-24755489 GAGTAGGAGACTGGGGAAGAGGG + Intergenic
1038329123 8:26593732-26593754 GGGTGGGTGCCGGGGGCAGAGGG + Intronic
1038474630 8:27856537-27856559 AAGTGGGAGCCGACGGGAGAGGG - Intergenic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039468076 8:37797601-37797623 GGGTGGGAGCAGGGGGAAGGGGG + Intronic
1040462700 8:47664129-47664151 CACTGGGGGCTGGGGGAAGAGGG - Intronic
1041304537 8:56446268-56446290 GAGCGGGAGCCGGGGGAGGCAGG + Intronic
1041568989 8:59314412-59314434 GAGAGGAAGCCTGGGGAAGAGGG - Intergenic
1041698566 8:60763002-60763024 CAGGGGGAGGTGGGAGAAGATGG + Intronic
1042872746 8:73413029-73413051 CAGGGGAAGCTGGGAGAAGAAGG - Intergenic
1043778193 8:84297189-84297211 CAGTGGGAGGAGGGAGAGGAAGG - Intronic
1047157536 8:122337594-122337616 CGGTGGGTGGTGGGGGAAGATGG + Intergenic
1047682072 8:127264510-127264532 TGGTGGGAGCAGGAGGAAGAGGG + Intergenic
1048357780 8:133667581-133667603 GAGTGGGAGGAGGAGGAAGAGGG - Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049245599 8:141560573-141560595 GGGAGGGAGCCAGGGGAAGAGGG + Intergenic
1049390101 8:142363371-142363393 CAGTGGGAACCAGGGGGAGAGGG + Intronic
1049822707 8:144645828-144645850 CAGGGGGAGCTGGGGGCAGCAGG + Intergenic
1050742617 9:8839766-8839788 CAGTGGGAGAAATGGGAAGAAGG + Intronic
1052051156 9:23850873-23850895 CATAGGGAGGTGGGGGAAGAGGG - Intergenic
1052880610 9:33599162-33599184 AAGCGGGACCCGGGAGAAGAGGG - Intergenic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1053164235 9:35833436-35833458 CAGTAGCAGACAGGGGAAGAGGG - Intronic
1053480547 9:38413434-38413456 CAGTGGGAGGAGGAGGAAGGAGG - Intronic
1053621888 9:39828037-39828059 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053837821 9:42159895-42159917 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053883197 9:42616235-42616257 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1053889472 9:42678064-42678086 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1054222221 9:62423708-62423730 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1054228492 9:62485464-62485486 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1055318413 9:75057240-75057262 CAGTGGGAAGGGGGAGAAGAGGG + Intergenic
1055985862 9:82056251-82056273 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1056433533 9:86552628-86552650 CAGTGGGAGCTGGGTAAGGATGG + Intergenic
1057028200 9:91752557-91752579 TAGTGGGTGCCTGGGGTAGAAGG + Intronic
1057186045 9:93058222-93058244 CAGTGAGAGACAGGGAAAGAAGG + Intergenic
1057675257 9:97132406-97132428 AAGTGGGACCCAGGAGAAGAGGG + Intergenic
1057676083 9:97137284-97137306 CAGTGGGAGCTGGGGGTGGAGGG - Intergenic
1059331738 9:113539847-113539869 TAGAGGGAGTCAGGGGAAGATGG + Intronic
1059438079 9:114288452-114288474 CAGGGGGAGCAGGGCGAGGACGG + Exonic
1059438709 9:114290807-114290829 CAGGGGGAGCAGGGAGACGATGG + Exonic
1059671178 9:116493784-116493806 CAGTGGGAGTGGGGGGATGTGGG + Intronic
1060859084 9:126939074-126939096 AAGTGGGAGAGGGGGGCAGAGGG + Intronic
1061424295 9:130489562-130489584 CAGTGGGCGGCAGGGGAGGAAGG - Intronic
1062303142 9:135887120-135887142 CAGTGAGAGCCGGGCGCAGTGGG + Intronic
1062525140 9:136975180-136975202 CAGTCCTAGCCGGGGGAGGAGGG + Intergenic
1062554123 9:137106376-137106398 CCGTGGGAGCTGGGGGCAGCAGG - Intronic
1185490942 X:516579-516601 CAGTGAGAGGAGGGGGGAGAAGG - Intergenic
1186875873 X:13817209-13817231 CAGTGGGAGTTGGGGGTAGGGGG + Exonic
1187007614 X:15247870-15247892 CAGTGAGAGTAGGAGGAAGAAGG + Intronic
1187380216 X:18794794-18794816 TACTGGGAGCTGGGGGAAGAAGG + Intronic
1187449518 X:19384345-19384367 CAGTGGGGACTGGGGGAAGGTGG + Intronic
1189309323 X:40008912-40008934 CAGCGGGAGCCGCGGGAGGAAGG - Intergenic
1189700940 X:43715962-43715984 CGGTTGGTGGCGGGGGAAGATGG + Intronic
1189997112 X:46649599-46649621 CTGTGGGAGCCAGAGGAACAGGG + Intronic
1190101082 X:47523679-47523701 CAGGGGGAGGCAGGGGAAGGGGG - Intergenic
1190380051 X:49830081-49830103 CAGTGGGGACCTGGGGAGGAGGG + Intronic
1192223143 X:69211022-69211044 CTGTGGCAGCTGGGGGGAGATGG - Intergenic
1195702612 X:107716432-107716454 CAGAGGCAGCCGGAGGCAGAGGG - Intronic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1199671987 X:150155344-150155366 CAGGTGGAGAAGGGGGAAGATGG - Intergenic
1199737446 X:150696883-150696905 AAGTGGGAGCAGGTGGAGGAAGG + Intronic
1199878812 X:151956503-151956525 CAGTGGGAGCCGGGTCATGGTGG - Intronic
1200167549 X:154047683-154047705 CAGTGGGAGCCAGGTGAGCAAGG + Intronic
1200236253 X:154469228-154469250 GAGTGGGAGCCAGGAGGAGAGGG - Intronic
1201920259 Y:19226336-19226358 CAGTGGGAGCCTGGACAAAATGG - Intergenic