ID: 1072191390

View in Genome Browser
Species Human (GRCh38)
Location 10:93079452-93079474
Sequence CTCTGCGAATGTAGTGCAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072191388_1072191390 17 Left 1072191388 10:93079412-93079434 CCTTTAAAACACTATCTTCGCTG No data
Right 1072191390 10:93079452-93079474 CTCTGCGAATGTAGTGCAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072191390 Original CRISPR CTCTGCGAATGTAGTGCAGT CGG Intergenic
No off target data available for this crispr