ID: 1072191390 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:93079452-93079474 |
Sequence | CTCTGCGAATGTAGTGCAGT CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1072191388_1072191390 | 17 | Left | 1072191388 | 10:93079412-93079434 | CCTTTAAAACACTATCTTCGCTG | No data | ||
Right | 1072191390 | 10:93079452-93079474 | CTCTGCGAATGTAGTGCAGTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1072191390 | Original CRISPR | CTCTGCGAATGTAGTGCAGT CGG | Intergenic | ||
No off target data available for this crispr |