ID: 1072194664

View in Genome Browser
Species Human (GRCh38)
Location 10:93106943-93106965
Sequence TACACAAGACTGCAGAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 264}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072194664_1072194671 19 Left 1072194664 10:93106943-93106965 CCACTTTTCTGCAGTCTTGTGTA 0: 1
1: 0
2: 1
3: 36
4: 264
Right 1072194671 10:93106985-93107007 AACCCAAGGAATGTCTGCCATGG 0: 1
1: 0
2: 2
3: 15
4: 156
1072194664_1072194665 5 Left 1072194664 10:93106943-93106965 CCACTTTTCTGCAGTCTTGTGTA 0: 1
1: 0
2: 1
3: 36
4: 264
Right 1072194665 10:93106971-93106993 TCCTGCCACCCCAAAACCCAAGG 0: 1
1: 0
2: 2
3: 29
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072194664 Original CRISPR TACACAAGACTGCAGAAAAG TGG (reversed) Intergenic
902890007 1:19436088-19436110 AAAACAAAACTGCAGATAAGGGG - Intronic
903060576 1:20665969-20665991 GAGACAAGACTGGAGCAAAGAGG + Intronic
903541230 1:24097446-24097468 TGCACCTGCCTGCAGAAAAGGGG + Intronic
904890538 1:33776322-33776344 CCCTCAAGACTGCAGTAAAGAGG + Intronic
908218891 1:61983709-61983731 TACAGAAGACTGCAGAGAGTTGG + Intronic
910375431 1:86564081-86564103 TACACAAGAATGCACAAACATGG + Intronic
911460491 1:98182942-98182964 TACACAAGACACCAGAAATCCGG - Intergenic
912147051 1:106806892-106806914 AACACAAGACTGCCCAAAACTGG + Intergenic
914044725 1:144081620-144081642 TACTCAAGAATGCATAAAAGAGG + Intergenic
914133385 1:144879066-144879088 TACTCAAGAATGCATAAAAGAGG - Intergenic
914439397 1:147690733-147690755 TACCTAAGGCTGCAGAAAGGTGG - Intergenic
914682587 1:149949659-149949681 TGGACACGAGTGCAGAAAAGTGG + Exonic
916908953 1:169323596-169323618 TACACAAGAAAGCAGAAATTTGG - Intronic
917190436 1:172412718-172412740 TATACAAGAATGAGGAAAAGGGG - Intronic
917240661 1:172945108-172945130 TCCACAGCCCTGCAGAAAAGAGG - Intergenic
918038067 1:180894735-180894757 TAAACAAGAGTGGAGAGAAGAGG - Intergenic
918529138 1:185498535-185498557 TAAACATGACAGTAGAAAAGGGG + Intergenic
919402677 1:197139078-197139100 TACCAAAAACTGCAGAAAATGGG - Intronic
921805547 1:219450171-219450193 AACACAGGACAGCAGAAAAGAGG - Intergenic
923905982 1:238384171-238384193 TCCCAAACACTGCAGAAAAGGGG - Intergenic
1062957648 10:1550939-1550961 TAAAAAGGACGGCAGAAAAGGGG + Intronic
1064773438 10:18749295-18749317 TATACAAGACTGCAGTTTAGGGG - Intergenic
1065673878 10:28153354-28153376 TAAAGAAGTCTGGAGAAAAGGGG + Intronic
1066956850 10:42181300-42181322 TACTCCAGAATGCATAAAAGGGG + Intergenic
1068210009 10:53909201-53909223 TTCACAAGGCAGCAGGAAAGAGG - Intronic
1068324411 10:55465498-55465520 TAAATAAGACTGATGAAAAGGGG - Intronic
1068943531 10:62705098-62705120 AGCACAAGACTGCAGGAAAGAGG + Intergenic
1069500043 10:68944019-68944041 TTCAAAAGAATGCAGAAAAGTGG - Intronic
1071265903 10:83964709-83964731 TATACATGACTGGAGCAAAGGGG + Intergenic
1072194664 10:93106943-93106965 TACACAAGACTGCAGAAAAGTGG - Intergenic
1072726801 10:97819315-97819337 TCCAAAAGAAGGCAGAAAAGGGG + Intergenic
1073829681 10:107367961-107367983 TCCAGAACAATGCAGAAAAGAGG + Intergenic
1074029210 10:109667867-109667889 ACCACAAGAAAGCAGAAAAGGGG + Intergenic
1074251878 10:111759088-111759110 TAGACATGACCTCAGAAAAGTGG + Intergenic
1074474932 10:113763523-113763545 TCCAAAAGAAGGCAGAAAAGGGG - Intronic
1074530484 10:114294960-114294982 TACACAACCCTCCAGAAATGAGG + Exonic
1074998815 10:118779978-118780000 TCCACAAGACTGATGAAGAGAGG - Intergenic
1075268039 10:121022481-121022503 AACACAAGAAAGCAGCAAAGGGG - Intergenic
1075293827 10:121254763-121254785 TACAGAAGACTGCAGAGTTGAGG + Intergenic
1075524357 10:123170512-123170534 GGCACAACACTGAAGAAAAGTGG - Intergenic
1078058510 11:8028526-8028548 TACAAAACACTGAAGAAAACAGG - Intronic
1079466649 11:20737072-20737094 TACACAGGACTGGAGAGGAGAGG - Intronic
1079787520 11:24693151-24693173 TACAGAAGAATGAAGAAAACTGG - Intronic
1083817856 11:65147161-65147183 TAACTAACACTGCAGAAAAGTGG - Intergenic
1086831279 11:91567940-91567962 GACAGAAAACTGCAGATAAGGGG + Intergenic
1087217284 11:95507608-95507630 CTCACAAAGCTGCAGAAAAGGGG + Intergenic
1088290193 11:108228163-108228185 TTCACAAGACTTCAGATTAGAGG + Intronic
1089777947 11:120852040-120852062 GAAGCAAGCCTGCAGAAAAGCGG + Intronic
1090115647 11:123969513-123969535 TACACAAAACTGGGGAAAACTGG - Intergenic
1091839964 12:3613783-3613805 GACAGAAGTCTGCAAAAAAGAGG + Intronic
1092221689 12:6718081-6718103 TACACACTATTGCAGAAAATAGG - Intergenic
1092309861 12:7340848-7340870 TACACCAACTTGCAGAAAAGTGG - Intergenic
1092711562 12:11343322-11343344 TACACAAAGATGAAGAAAAGGGG - Intergenic
1093255086 12:16856990-16857012 TACAAAAGCCTGAAGAAAAAAGG - Intergenic
1093702059 12:22232466-22232488 TACACAGGTTTGCAGAAAAGGGG + Intronic
1095810505 12:46369777-46369799 TACAGAAGACTTCAGAGCAGTGG - Intronic
1096897128 12:54833545-54833567 TGAATAAGACTTCAGAAAAGGGG - Intronic
1100738618 12:97566182-97566204 CACACAAGAGTACAGGAAAGGGG - Intergenic
1101203924 12:102466311-102466333 TAGACAAGTCTCCAGAAGAGAGG - Intronic
1102008337 12:109602938-109602960 CAAACGAGGCTGCAGAAAAGTGG + Intergenic
1102599226 12:114016458-114016480 TACATAAGAATGGAGAAAAGTGG - Intergenic
1103017945 12:117510300-117510322 TAACCAAGACTACAGAAAAGTGG - Intronic
1103384791 12:120523556-120523578 TAATTAAGACAGCAGAAAAGAGG - Intronic
1105422347 13:20264273-20264295 TACACAATAGTGAAGAAAAAAGG - Intergenic
1106669351 13:31888329-31888351 TCAACAAGACTACAGAGAAGTGG + Intergenic
1107289197 13:38833157-38833179 CAAACAAAACTGCAGAAAAATGG - Intronic
1108498653 13:51048804-51048826 TAGCCAAGCCTGCTGAAAAGAGG + Intergenic
1109480281 13:62944308-62944330 TTCACAAGACTCCTCAAAAGAGG - Intergenic
1110486541 13:76051344-76051366 TACATAAAACTACACAAAAGTGG + Intergenic
1111749742 13:92313876-92313898 CACACAAGAGTGAAGAAAATTGG + Intronic
1112329455 13:98465683-98465705 TACATAAGAGTTAAGAAAAGGGG + Intronic
1113158023 13:107347637-107347659 TAAACAAGATTGCGGAAATGAGG - Intronic
1113243663 13:108369234-108369256 TTCACAGGACTGCAGGAGAGAGG - Intergenic
1113379705 13:109791392-109791414 TGCAAACAACTGCAGAAAAGCGG - Intergenic
1114857695 14:26469627-26469649 CACACAAGACTGGAGAGCAGTGG + Intronic
1115344112 14:32323827-32323849 ACCACAAGACTCCAGAGAAGAGG + Intergenic
1115380172 14:32727952-32727974 CACACAAGTCTTCTGAAAAGCGG + Intronic
1117700334 14:58406031-58406053 TTAAGAAGACTGCAGAAAACTGG - Intronic
1117809645 14:59533047-59533069 TGCACAAGACAGCAGACCAGTGG + Intronic
1118733891 14:68688870-68688892 TACAGAAAAGTGCAGAAGAGGGG - Intronic
1119370784 14:74140468-74140490 TACACCAGACATCAGATAAGAGG - Intronic
1120246800 14:82016352-82016374 TACTGAAAACTGAAGAAAAGTGG - Intergenic
1120512387 14:85431058-85431080 TTCACAAGGCTGCAGGAGAGAGG + Intergenic
1120632465 14:86906914-86906936 AAAAGAAGACTCCAGAAAAGAGG + Intronic
1121034333 14:90687769-90687791 TCAACAAGGCTGTAGAAAAGGGG + Intronic
1121613517 14:95297260-95297282 TAAGCAGGACTGCACAAAAGTGG - Intronic
1202936262 14_KI270725v1_random:90480-90502 TACTCAAGAATGCATAAAAGGGG - Intergenic
1123469883 15:20541790-20541812 TGCACTAGAATGCAGAATAGGGG + Exonic
1123494087 15:20806858-20806880 TAAAAAAGACTGGAGAAAATGGG + Intergenic
1123550585 15:21375940-21375962 TAAAAAAGACTGGAGAAAATGGG + Intergenic
1123648172 15:22458891-22458913 TGCACTAGAATGCAGAATAGGGG - Intronic
1123683049 15:22776146-22776168 CTCACTAGAATGCAGAAAAGGGG + Intronic
1123730177 15:23136812-23136834 TGCACTAGAATGCAGAATAGGGG + Exonic
1123748315 15:23334222-23334244 TGCACTAGAATGCAGAATAGGGG + Intergenic
1123763078 15:23447269-23447291 TGCACTAGAATGCAGAATAGGGG + Intergenic
1124280693 15:28358109-28358131 TGCACTAGAATGCAGAATAGGGG + Intergenic
1124302011 15:28553520-28553542 TGCACTAGAATGCAGAATAGGGG - Intergenic
1124334801 15:28848670-28848692 TGCACTAGAATGCGGAAAAGGGG + Intergenic
1124460148 15:29882487-29882509 TTCAATAGACTGCAGAAAATGGG + Intronic
1124969376 15:34470389-34470411 AAGACAAGTCTGCAGAAAACAGG + Intergenic
1125853110 15:42922989-42923011 TGGAAAAGACTGGAGAAAAGGGG - Intergenic
1125889212 15:43253213-43253235 TAAAAAACACTTCAGAAAAGAGG + Intronic
1126111392 15:45177003-45177025 AACACAAGCCTGCAGAATGGAGG - Intronic
1127039789 15:54962047-54962069 TACACAATGCAGGAGAAAAGAGG - Intergenic
1128723591 15:69971352-69971374 TACACAAGTCAGAAGAAAGGAGG + Intergenic
1129036690 15:72654649-72654671 CACACTAGAATGCAGAATAGGGG - Intergenic
1129213197 15:74082576-74082598 CACACTAGAATGCAGAATAGGGG + Intergenic
1129224397 15:74159016-74159038 TACATAACACTGCTAAAAAGAGG + Intergenic
1129397202 15:75258510-75258532 CACACTAGAATGCAGAATAGGGG - Intergenic
1129400814 15:75282787-75282809 CACACTAGAATGCAGAATAGGGG - Intronic
1129730330 15:77926892-77926914 CACACTAGAATGCAGAATAGGGG + Intergenic
1130578521 15:85114879-85114901 GCCACAGGACTGGAGAAAAGGGG + Intronic
1130701595 15:86188578-86188600 AACACAACAGTGCTGAAAAGGGG + Intronic
1131869923 15:96753267-96753289 TCCAAAAGAAGGCAGAAAAGGGG + Intergenic
1202958928 15_KI270727v1_random:103194-103216 TAAAAAAGACTGGAGAAAATGGG + Intergenic
1134472915 16:14543744-14543766 TCCAAAAGAAGGCAGAAAAGGGG + Intronic
1140908799 16:79432577-79432599 AAAACAAAACTGCAGATAAGGGG + Intergenic
1141043549 16:80693427-80693449 TAAACAAGACAGCAGAAATGAGG + Intronic
1142896113 17:2980263-2980285 TGCACAAGACGGGAGAAAAAAGG - Intronic
1142905982 17:3042175-3042197 TACTCAAGACTACTGCAAAGGGG - Intergenic
1144134701 17:12282119-12282141 TAAATAATACTGCAGAAAACAGG - Intergenic
1144736619 17:17559211-17559233 GACATAGGACTTCAGAAAAGGGG + Intronic
1145805634 17:27726860-27726882 AACACAATACTGAACAAAAGTGG + Intergenic
1148721643 17:49757631-49757653 TCCACACGACTGGAGAAAATGGG + Intronic
1149042421 17:52205788-52205810 TAGACAAGACTGGAGACAGGGGG - Intergenic
1150841281 17:68608550-68608572 TACAAAAGAAAGCAGAAAAGGGG + Intergenic
1153116936 18:1669432-1669454 TACAAAAGACTGCAAGAAAAGGG + Intergenic
1153692445 18:7607072-7607094 CACAAAAGACTTCAGAAAGGTGG + Intronic
1153993760 18:10422543-10422565 TACACTTGACGGCAGAGAAGGGG - Intergenic
1154191439 18:12234163-12234185 GAGACAAAACAGCAGAAAAGTGG - Intergenic
1157630905 18:49094169-49094191 TTCACTAAACTGAAGAAAAGAGG + Intronic
1160526791 18:79543186-79543208 TGCACAAGAGGGCAGCAAAGTGG - Intergenic
1162516203 19:11149336-11149358 GACACAGGGCTGCAGACAAGGGG - Intronic
1163612964 19:18310506-18310528 TAACCAAGACTGGAGAAATGGGG + Intronic
1167977711 19:53243949-53243971 CACACAAAATGGCAGAAAAGAGG + Intronic
1202684283 1_KI270712v1_random:35025-35047 TACTCAAGAATGCATAAAAGAGG + Intergenic
925042586 2:744439-744461 TCCAAAAGAATGCGGAAAAGAGG - Intergenic
925480497 2:4265897-4265919 TACACAATATGGAAGAAAAGAGG - Intergenic
926154388 2:10444539-10444561 TACATTTGACTGCATAAAAGGGG + Exonic
928807093 2:35172481-35172503 TACATAACACTGCAAATAAGAGG + Intergenic
929072122 2:38041999-38042021 TACAAGAGATTGCAGAAAATTGG + Intronic
931054309 2:58451817-58451839 TACAGAACACTGCAGGAAAAGGG - Intergenic
932061277 2:68501050-68501072 TACACAAGATTGCATAAGAATGG - Intronic
933696361 2:85221578-85221600 TGCACAAGACGGCAGAATGGGGG + Intronic
934247435 2:90319822-90319844 TACTCAAGAATGCATAAAAGAGG - Intergenic
934261890 2:91482781-91482803 TACTCAAGAATGCATAAAAGAGG + Intergenic
934304931 2:91813770-91813792 TACTCAAGGATGCATAAAAGGGG + Intergenic
934328326 2:92038978-92039000 TACTCAAGGATGCATAAAAGGGG - Intergenic
934466704 2:94269519-94269541 TACTCAAGAATGCATAAAAGGGG - Intergenic
934790656 2:97057177-97057199 TATTCAAGGATGCAGAAAAGGGG + Intergenic
934815802 2:97325352-97325374 TATTCAAGGATGCAGAAAAGGGG - Intergenic
934821893 2:97383131-97383153 TATTCAAGGATGCAGAAAAGGGG + Intergenic
937017560 2:118619590-118619612 CACCCAAGCCTGCAGGAAAGTGG - Intergenic
937482749 2:122279456-122279478 TACAAAATAGTGCAGAAAATAGG + Intergenic
938715558 2:134018440-134018462 TACACAATACTCCAGAAAATGGG - Intergenic
938802936 2:134779414-134779436 TCCATATGCCTGCAGAAAAGTGG + Intergenic
939994459 2:148907168-148907190 TTCACAGGACAGCAGCAAAGAGG - Intronic
941614393 2:167702796-167702818 TGCACAAGACTGGGGACAAGGGG - Intergenic
948554890 2:238802084-238802106 GACGCATGACTGCAGAAAACTGG + Intergenic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1169221267 20:3824417-3824439 GACACAAGCCTGCAGAAAGGGGG + Exonic
1169288728 20:4330995-4331017 TACAGAAGGATACAGAAAAGGGG + Intergenic
1169477063 20:5941102-5941124 TACACAAAACTGCGGGAGAGGGG - Exonic
1170162162 20:13324420-13324442 TACCCAAAGATGCAGAAAAGAGG + Intergenic
1171510804 20:25683086-25683108 CACAGGAGACTGCTGAAAAGTGG - Intronic
1173198281 20:40934058-40934080 TACACAAGAATGCAAAAGTGGGG + Intergenic
1173214079 20:41063575-41063597 CTCACAAGGCTGCAGAAAAAAGG - Intronic
1173339774 20:42142836-42142858 AAAACAAAACTGCAGATAAGGGG + Intronic
1176587238 21:8599125-8599147 TACTCAAGAATGCATAAAAGGGG + Intergenic
1177447285 21:21214286-21214308 TACTAAAGAATGCAGAAAATGGG - Intronic
1177834595 21:26174155-26174177 AACACAAGACGACAGAAACGCGG - Intergenic
1178899146 21:36584997-36585019 AACAGAAGAATGAAGAAAAGAGG + Intergenic
1180270069 22:10576122-10576144 TACTCAAGAATGCATAAAAGGGG + Intergenic
1180280614 22:10690156-10690178 TACTCAAGAATGCATAAAAGGGG - Intergenic
1180587836 22:16908694-16908716 TACGCAAGAATGCATAAAAGGGG - Intergenic
1181893047 22:26081636-26081658 TCCAAAGGCCTGCAGAAAAGGGG - Intergenic
949400220 3:3657830-3657852 TTCACAAGACCGCTGAAAAAAGG + Intergenic
951800033 3:26585629-26585651 TAGACAAGTTTGCAGAAAAGTGG + Intergenic
952224228 3:31357824-31357846 TACACGAGAGTACAGAAAATTGG - Intergenic
953847034 3:46435877-46435899 TACCCAAGACTGCAAGAAAGAGG + Exonic
956230480 3:67010333-67010355 TACACAAGATTGTCAAAAAGCGG - Exonic
961047443 3:123719394-123719416 CACACAATACTGTAGCAAAGTGG + Intronic
961270519 3:125684240-125684262 CACACAATACTGTAGCAAAGTGG - Intergenic
961434684 3:126908819-126908841 CCCACAAAACTGCAGAAAGGAGG + Intronic
962357629 3:134708494-134708516 TAGACAGAACTGCAGAACAGGGG - Intronic
963338389 3:144003577-144003599 TCCCCAAGACTGGAGAGAAGGGG - Intronic
964474706 3:157088369-157088391 TTCAAAAGACTGCACACAAGGGG + Intergenic
964478233 3:157116360-157116382 TGCAAAAGACTGCTGAAAACTGG + Intergenic
965134763 3:164748748-164748770 TACAGAAGAAAGTAGAAAAGAGG - Intergenic
966456549 3:180123118-180123140 TACATGAGAAGGCAGAAAAGAGG - Intergenic
966902562 3:184497345-184497367 TACACAAGAGCACAGAAAACAGG - Intronic
967597602 3:191345630-191345652 TACACCAGATTGCAGGCAAGCGG - Intronic
967799207 3:193636529-193636551 TACACAGGCCTGAAAAAAAGGGG - Intronic
970091059 4:12408629-12408651 ATCACAAGACTACTGAAAAGTGG + Intergenic
970649716 4:18162896-18162918 TAGACAAGAATGCAGAGAAAAGG - Intergenic
971658212 4:29377770-29377792 TAAACAAGGCAGCAGAAAAATGG - Intergenic
972577171 4:40362766-40362788 TACAAAATACTACAGCAAAGCGG + Intergenic
973537345 4:51896667-51896689 TACACAAGAAAGCAGTAAACAGG - Intronic
975456068 4:74591605-74591627 TTTAAAAGGCTGCAGAAAAGAGG - Intergenic
976177827 4:82373061-82373083 TGCCCAAGACTGTAGAAAAAGGG + Intronic
978956414 4:114618478-114618500 TACACATGAGTTCTGAAAAGTGG - Intronic
979538968 4:121857495-121857517 TACACAAAACTGTTAAAAAGAGG + Intronic
981925483 4:150134738-150134760 CACACCAGGCTGCAGAAAACAGG - Intronic
982542795 4:156695561-156695583 GACACAAGCCAGCATAAAAGCGG - Intergenic
982596552 4:157392931-157392953 CACACAAGTCTAGAGAAAAGTGG + Intergenic
982689306 4:158529997-158530019 TACACAACACTGAAAAAAATCGG - Intronic
983110092 4:163738933-163738955 TACCCAAGACTGAAAAGAAGGGG + Intronic
983305670 4:165982646-165982668 TAAATAAAAATGCAGAAAAGTGG + Intronic
983331971 4:166341565-166341587 TACATCATACTGCAGAGAAGGGG - Intergenic
986119073 5:4814020-4814042 TAGACAAGATTTCAGAAATGGGG + Intergenic
986393651 5:7306680-7306702 TGCACTAGAATGCGGAAAAGGGG + Intergenic
986850240 5:11803341-11803363 TGCACAAGAGTGCACAAGAGGGG + Intronic
987313243 5:16700711-16700733 TGCCCAAGACTTCAGAAAACTGG - Intronic
987467416 5:18288777-18288799 TACTCAAGGATGAAGAAAAGGGG - Intergenic
990160441 5:52933279-52933301 TACAGAAAAATACAGAAAAGTGG - Intronic
992972699 5:82079028-82079050 TACACATAAAAGCAGAAAAGAGG - Intronic
993220543 5:85090543-85090565 TACATAAAACTGAATAAAAGTGG + Intergenic
994847325 5:105005970-105005992 TACAGAAGACTACAACAAAGGGG - Intergenic
996840203 5:127839643-127839665 TACACAACATTGCAGGGAAGTGG + Intergenic
998281976 5:140819231-140819253 TATACCAGATTGCAGAGAAGAGG - Intronic
998793467 5:145791825-145791847 TACACAGAAAAGCAGAAAAGAGG + Intronic
999446226 5:151641930-151641952 TATGCAAGAATGCAGAAAAAAGG + Intergenic
1000282280 5:159792715-159792737 TACAAAGGACAGCAGGAAAGGGG - Intergenic
1000978104 5:167786925-167786947 TAAAGAAGAGTGAAGAAAAGTGG - Intronic
1003672885 6:8176027-8176049 TACCAAAGACTTCACAAAAGAGG - Intergenic
1003801630 6:9676435-9676457 CACACAAGATGGCAGAAAATGGG - Intronic
1003975645 6:11341234-11341256 AACACCAGACTGCAAAAATGGGG + Intronic
1005494385 6:26375851-26375873 AAAAATAGACTGCAGAAAAGGGG + Intronic
1005498877 6:26412759-26412781 AAAAATAGACTGCAGAAAAGGGG + Intronic
1005503631 6:26451286-26451308 AAAAATAGACTGCAGAAAAGGGG + Intronic
1005508251 6:26489056-26489078 TACAAGATACTGCAGGAAAGAGG - Intergenic
1006149707 6:31980353-31980375 TACACAAGTCTCCAGAAACACGG - Intronic
1007117277 6:39351733-39351755 TACCCAAGAGATCAGAAAAGAGG + Intronic
1008789170 6:55208702-55208724 TACACATCACAGCAGAAAATGGG - Intronic
1010011160 6:71050096-71050118 TCCACAAGATTCCACAAAAGAGG + Intergenic
1010278284 6:73993939-73993961 GGCACAGGACTGCATAAAAGGGG - Intergenic
1010495994 6:76533791-76533813 TTCACATGCCTCCAGAAAAGGGG - Intergenic
1010504753 6:76643270-76643292 GAAACAAAACTGAAGAAAAGAGG - Intergenic
1010973288 6:82285880-82285902 TACAATAGACCACAGAAAAGGGG + Intergenic
1017201848 6:151763335-151763357 CACACAAGAATGCAGCAAAGTGG - Intronic
1017625536 6:156343781-156343803 TGCACCTGACTGAAGAAAAGTGG - Intergenic
1018355790 6:163014490-163014512 TTGGCAAGACTGCAGAAAAAAGG - Intronic
1018537073 6:164832152-164832174 CACACAAAACTACAGAAAATTGG - Intergenic
1020631311 7:10643627-10643649 TACAGCAGACATCAGAAAAGAGG + Intergenic
1021370536 7:19839553-19839575 TTGACAAGACTGCAGAGAAAAGG - Intergenic
1021912453 7:25400064-25400086 TAAGCAAAACTGCAGATAAGTGG - Intergenic
1022828290 7:34039036-34039058 TTCACAAGCCTGAAGAAAAGTGG + Intronic
1023321062 7:38998166-38998188 TTCACATGACTGTTGAAAAGGGG - Intronic
1023707772 7:42960119-42960141 TAAAAAAGACTGGATAAAAGAGG + Intergenic
1023777452 7:43621388-43621410 TACACAAGACTGCAGAATGTAGG + Intronic
1024309417 7:47955780-47955802 TAAACTAGACTCCAGGAAAGTGG + Intronic
1024788251 7:52932749-52932771 TACAAAAGAATGAAGAAAACAGG - Intergenic
1025060962 7:55807126-55807148 TACCAAAAACTGCAGAAAATGGG - Exonic
1025616811 7:63126368-63126390 TACCAAAAACTGCAGAAAATGGG - Intergenic
1028662717 7:93299013-93299035 TATACAATACTGCAAAAAAACGG - Intronic
1030205460 7:106948433-106948455 CCCAGAGGACTGCAGAAAAGTGG - Intergenic
1030260913 7:107563594-107563616 TCCCCAAGACTCCAGAAAAGAGG + Intronic
1030937478 7:115603175-115603197 TAGAAAAGGCTGTAGAAAAGTGG + Intergenic
1031543820 7:123028201-123028223 TACATAAGAAGGTAGAAAAGTGG + Intergenic
1034850663 7:154490384-154490406 TGCAAAAGACTGCAGCAAGGAGG - Intronic
1035370792 7:158377696-158377718 TACGCACGACAGCTGAAAAGTGG + Intronic
1036533289 8:9618439-9618461 TACACAATAATTCAGCAAAGAGG - Intronic
1036770342 8:11574733-11574755 TACAGAAGACTCCAGCAATGCGG - Intergenic
1037370461 8:18171689-18171711 TACACAATTCTGCAGACAAAAGG + Intronic
1037756519 8:21713516-21713538 TACATAAGCCTCCAGCAAAGGGG + Intronic
1039038937 8:33388669-33388691 CACAGAAAACTGCAGAAAAGGGG - Intronic
1039655900 8:39406166-39406188 AAAACAAAACTGCAGATAAGAGG + Intergenic
1042047752 8:64673091-64673113 TCCACAAGACTAGAGCAAAGGGG - Intronic
1043510768 8:80948276-80948298 TACAAAAGACTAAAGAAAAATGG + Intergenic
1043988846 8:86727148-86727170 AATAAAAGACTGCATAAAAGAGG - Intronic
1044108468 8:88240966-88240988 TATACAAGAATGTAGAAAGGAGG - Intronic
1044123012 8:88421293-88421315 AAAACAAAACTGCAGATAAGGGG + Intergenic
1046166075 8:110437685-110437707 TACATAATACTGCAGATAAAGGG + Intergenic
1047359671 8:124156653-124156675 TTGGCAAGACTGCAGAGAAGAGG - Intergenic
1048872157 8:138808087-138808109 TACACAAGTAAGCAGAAATGTGG - Intronic
1048884219 8:138896546-138896568 TCCACAAGAGGGCACAAAAGGGG + Intronic
1049084148 8:140464719-140464741 TACACAAGGCTGAAAAAAAGAGG + Intergenic
1052052990 9:23869638-23869660 AACAGAAGAATGGAGAAAAGAGG - Intergenic
1052217926 9:25989456-25989478 TTCACAAGGCAGCAGACAAGAGG + Intergenic
1052704931 9:31983234-31983256 TAGAAAAAGCTGCAGAAAAGAGG + Intergenic
1053328913 9:37185600-37185622 CACACCAGACACCAGAAAAGAGG - Intronic
1054440365 9:65255003-65255025 TACTCAAGAATGCATAAAAGGGG - Intergenic
1054490042 9:65766935-65766957 TACTCAAGAATGCATAAAAGGGG + Intergenic
1055664183 9:78536807-78536829 AAAACAAAACTGCAGAGAAGAGG - Intergenic
1057202797 9:93151712-93151734 TCCACAAGACTGTAGGACAGAGG + Intergenic
1057882549 9:98803455-98803477 CCCACATGACTGCAGAACAGTGG + Intergenic
1060684779 9:125599304-125599326 TGCCAAAGACTGAAGAAAAGGGG - Intronic
1060943182 9:127555256-127555278 TACACAGGACAGCAGAAAGGTGG - Intronic
1203586272 Un_KI270747v1:6361-6383 TACTCAAGAATGCATAAAAGGGG - Intergenic
1203617197 Un_KI270749v1:76836-76858 TACTCAAGAATGCATAAAAGGGG + Intergenic
1186076444 X:5884691-5884713 TGCCCAAGTCTGGAGAAAAGGGG + Intronic
1188995546 X:36880699-36880721 CACACAAAACTGTAGAAACGAGG - Intergenic
1189063849 X:37784825-37784847 GACATAAGGCTGGAGAAAAGAGG + Intronic
1191788657 X:64945335-64945357 TCCAGCAGACTGCAGAAGAGGGG - Intronic
1192618012 X:72648048-72648070 TACAAAATACTGCAGAATAAAGG + Intronic
1193020025 X:76781523-76781545 TACACAAGGCTGCAAAAAAGAGG - Intergenic
1193740496 X:85210829-85210851 TAAAGAAGATTGCAGAAAAGAGG + Intergenic
1198301609 X:135339096-135339118 TACAGATGACTGCAGCAAGGAGG + Intronic
1199726152 X:150584352-150584374 TACATAAGACTTCAGAAACATGG + Intronic
1200618444 Y:5410722-5410744 TACACAAGAATACAAAGAAGGGG - Intronic
1201194484 Y:11478261-11478283 TACTCAAGAATGCATAAAAGGGG - Intergenic
1201518793 Y:14849299-14849321 TGCCCAAGTCTGGAGAAAAGGGG - Intergenic