ID: 1072195058

View in Genome Browser
Species Human (GRCh38)
Location 10:93110386-93110408
Sequence AAATCTGCACAGATGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072195058_1072195061 22 Left 1072195058 10:93110386-93110408 CCTGGCTGCATCTGTGCAGATTT No data
Right 1072195061 10:93110431-93110453 TCCACAAAAGGCAGCTTTGCAGG No data
1072195058_1072195059 10 Left 1072195058 10:93110386-93110408 CCTGGCTGCATCTGTGCAGATTT No data
Right 1072195059 10:93110419-93110441 TGCCAAGTCTCTTCCACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072195058 Original CRISPR AAATCTGCACAGATGCAGCC AGG (reversed) Intergenic
No off target data available for this crispr