ID: 1072195784

View in Genome Browser
Species Human (GRCh38)
Location 10:93116266-93116288
Sequence CACTGTCTTTGAGGGGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072195784_1072195791 7 Left 1072195784 10:93116266-93116288 CCTTGTGCCCCTCAAAGACAGTG No data
Right 1072195791 10:93116296-93116318 CCTGCCAGCCTCTTCCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072195784 Original CRISPR CACTGTCTTTGAGGGGCACA AGG (reversed) Intergenic
No off target data available for this crispr