ID: 1072200669

View in Genome Browser
Species Human (GRCh38)
Location 10:93155873-93155895
Sequence ATGGAGAATAAGAAAAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072200664_1072200669 24 Left 1072200664 10:93155826-93155848 CCTTAACTTTGAAAACTCTTATG No data
Right 1072200669 10:93155873-93155895 ATGGAGAATAAGAAAAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072200669 Original CRISPR ATGGAGAATAAGAAAAAGGA AGG Intergenic
No off target data available for this crispr