ID: 1072205217

View in Genome Browser
Species Human (GRCh38)
Location 10:93197887-93197909
Sequence CTCCCAATTCTTGTTCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072205217_1072205221 -10 Left 1072205217 10:93197887-93197909 CCTCTGGGAACAAGAATTGGGAG No data
Right 1072205221 10:93197900-93197922 GAATTGGGAGTGGGGAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072205217 Original CRISPR CTCCCAATTCTTGTTCCCAG AGG (reversed) Intergenic
No off target data available for this crispr