ID: 1072206478

View in Genome Browser
Species Human (GRCh38)
Location 10:93209738-93209760
Sequence CCCCCCAAAAAAAAAACCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072206467_1072206478 13 Left 1072206467 10:93209702-93209724 CCAAAAATAGGTCATGCATTTGA No data
Right 1072206478 10:93209738-93209760 CCCCCCAAAAAAAAAACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072206478 Original CRISPR CCCCCCAAAAAAAAAACCTG GGG Intergenic
No off target data available for this crispr