ID: 1072209381

View in Genome Browser
Species Human (GRCh38)
Location 10:93232573-93232595
Sequence CAGCTCGGTCAGTTTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072209376_1072209381 9 Left 1072209376 10:93232541-93232563 CCACTGTCATTCTCTAAGATCCA No data
Right 1072209381 10:93232573-93232595 CAGCTCGGTCAGTTTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072209381 Original CRISPR CAGCTCGGTCAGTTTGAGGC AGG Intergenic
No off target data available for this crispr