ID: 1072211225

View in Genome Browser
Species Human (GRCh38)
Location 10:93248801-93248823
Sequence GCTCAGCCCATGCATGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072211225_1072211237 27 Left 1072211225 10:93248801-93248823 CCTGTTCCATGCATGGGCTGAGC No data
Right 1072211237 10:93248851-93248873 ATGGGCTAGCACCTTTGCAAGGG No data
1072211225_1072211230 0 Left 1072211225 10:93248801-93248823 CCTGTTCCATGCATGGGCTGAGC No data
Right 1072211230 10:93248824-93248846 AGGCGGATCCAGGTTAGCAGAGG No data
1072211225_1072211229 -10 Left 1072211225 10:93248801-93248823 CCTGTTCCATGCATGGGCTGAGC No data
Right 1072211229 10:93248814-93248836 TGGGCTGAGCAGGCGGATCCAGG No data
1072211225_1072211234 9 Left 1072211225 10:93248801-93248823 CCTGTTCCATGCATGGGCTGAGC No data
Right 1072211234 10:93248833-93248855 CAGGTTAGCAGAGGCCGGATGGG No data
1072211225_1072211233 8 Left 1072211225 10:93248801-93248823 CCTGTTCCATGCATGGGCTGAGC No data
Right 1072211233 10:93248832-93248854 CCAGGTTAGCAGAGGCCGGATGG No data
1072211225_1072211231 4 Left 1072211225 10:93248801-93248823 CCTGTTCCATGCATGGGCTGAGC No data
Right 1072211231 10:93248828-93248850 GGATCCAGGTTAGCAGAGGCCGG No data
1072211225_1072211236 26 Left 1072211225 10:93248801-93248823 CCTGTTCCATGCATGGGCTGAGC No data
Right 1072211236 10:93248850-93248872 GATGGGCTAGCACCTTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072211225 Original CRISPR GCTCAGCCCATGCATGGAAC AGG (reversed) Intergenic
No off target data available for this crispr