ID: 1072211233

View in Genome Browser
Species Human (GRCh38)
Location 10:93248832-93248854
Sequence CCAGGTTAGCAGAGGCCGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072211227_1072211233 2 Left 1072211227 10:93248807-93248829 CCATGCATGGGCTGAGCAGGCGG No data
Right 1072211233 10:93248832-93248854 CCAGGTTAGCAGAGGCCGGATGG No data
1072211223_1072211233 10 Left 1072211223 10:93248799-93248821 CCCCTGTTCCATGCATGGGCTGA No data
Right 1072211233 10:93248832-93248854 CCAGGTTAGCAGAGGCCGGATGG No data
1072211219_1072211233 22 Left 1072211219 10:93248787-93248809 CCTGAGATACCTCCCCTGTTCCA No data
Right 1072211233 10:93248832-93248854 CCAGGTTAGCAGAGGCCGGATGG No data
1072211224_1072211233 9 Left 1072211224 10:93248800-93248822 CCCTGTTCCATGCATGGGCTGAG No data
Right 1072211233 10:93248832-93248854 CCAGGTTAGCAGAGGCCGGATGG No data
1072211218_1072211233 25 Left 1072211218 10:93248784-93248806 CCTCCTGAGATACCTCCCCTGTT No data
Right 1072211233 10:93248832-93248854 CCAGGTTAGCAGAGGCCGGATGG No data
1072211225_1072211233 8 Left 1072211225 10:93248801-93248823 CCTGTTCCATGCATGGGCTGAGC No data
Right 1072211233 10:93248832-93248854 CCAGGTTAGCAGAGGCCGGATGG No data
1072211222_1072211233 13 Left 1072211222 10:93248796-93248818 CCTCCCCTGTTCCATGCATGGGC No data
Right 1072211233 10:93248832-93248854 CCAGGTTAGCAGAGGCCGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072211233 Original CRISPR CCAGGTTAGCAGAGGCCGGA TGG Intergenic
No off target data available for this crispr