ID: 1072222884

View in Genome Browser
Species Human (GRCh38)
Location 10:93341659-93341681
Sequence TAGTTCATGTGGAAAGGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072222881_1072222884 -10 Left 1072222881 10:93341646-93341668 CCTACATGATCATTAGTTCATGT 0: 1
1: 0
2: 0
3: 10
4: 147
Right 1072222884 10:93341659-93341681 TAGTTCATGTGGAAAGGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072222884 Original CRISPR TAGTTCATGTGGAAAGGTTA TGG Intronic
No off target data available for this crispr