ID: 1072224505

View in Genome Browser
Species Human (GRCh38)
Location 10:93355984-93356006
Sequence AAACCCTGCTACTGAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072224499_1072224505 3 Left 1072224499 10:93355958-93355980 CCTCCTACCTCCAGTCCAGGTTT 0: 1
1: 0
2: 1
3: 21
4: 229
Right 1072224505 10:93355984-93356006 AAACCCTGCTACTGAAAGAAAGG No data
1072224496_1072224505 8 Left 1072224496 10:93355953-93355975 CCAGCCCTCCTACCTCCAGTCCA 0: 1
1: 0
2: 4
3: 62
4: 604
Right 1072224505 10:93355984-93356006 AAACCCTGCTACTGAAAGAAAGG No data
1072224498_1072224505 4 Left 1072224498 10:93355957-93355979 CCCTCCTACCTCCAGTCCAGGTT 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1072224505 10:93355984-93356006 AAACCCTGCTACTGAAAGAAAGG No data
1072224501_1072224505 -4 Left 1072224501 10:93355965-93355987 CCTCCAGTCCAGGTTTGCCAAAC 0: 1
1: 0
2: 2
3: 10
4: 119
Right 1072224505 10:93355984-93356006 AAACCCTGCTACTGAAAGAAAGG No data
1072224500_1072224505 0 Left 1072224500 10:93355961-93355983 CCTACCTCCAGTCCAGGTTTGCC 0: 1
1: 0
2: 1
3: 18
4: 186
Right 1072224505 10:93355984-93356006 AAACCCTGCTACTGAAAGAAAGG No data
1072224495_1072224505 26 Left 1072224495 10:93355935-93355957 CCGAGCAGGAAGTGGGAGCCAGC 0: 1
1: 0
2: 3
3: 42
4: 311
Right 1072224505 10:93355984-93356006 AAACCCTGCTACTGAAAGAAAGG No data
1072224502_1072224505 -7 Left 1072224502 10:93355968-93355990 CCAGTCCAGGTTTGCCAAACCCT 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1072224505 10:93355984-93356006 AAACCCTGCTACTGAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072224505 Original CRISPR AAACCCTGCTACTGAAAGAA AGG Intronic
No off target data available for this crispr