ID: 1072227048

View in Genome Browser
Species Human (GRCh38)
Location 10:93379985-93380007
Sequence TGCCTGGTATAAAACATTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072227043_1072227048 0 Left 1072227043 10:93379962-93379984 CCAAGGCAAGTAATAATAGTAGT 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1072227048 10:93379985-93380007 TGCCTGGTATAAAACATTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 101
1072227042_1072227048 1 Left 1072227042 10:93379961-93379983 CCCAAGGCAAGTAATAATAGTAG 0: 1
1: 0
2: 0
3: 14
4: 182
Right 1072227048 10:93379985-93380007 TGCCTGGTATAAAACATTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072227048 Original CRISPR TGCCTGGTATAAAACATTGG GGG Exonic
903014570 1:20353706-20353728 TCCCTGGGCTAAAACATTTGAGG + Intronic
904506798 1:30963277-30963299 TGCCTGGCTTTAAACACTGGGGG - Intronic
912739005 1:112175985-112176007 TGCCTGGTATACAGCATTAGTGG + Intergenic
917666135 1:177227635-177227657 TGCTTATTATAAAACATTTGAGG + Intronic
921316524 1:213896810-213896832 TGCCTGGTATATATCTTTAGGGG - Intergenic
922801447 1:228366508-228366530 TGCCTGGCCCAAAACACTGGTGG + Exonic
1064718262 10:18199835-18199857 AGCTTGGTCTAGAACATTGGTGG + Intronic
1066530575 10:36333818-36333840 TGCCTAGAATAAAACATTAAAGG + Intergenic
1071977121 10:90966213-90966235 TGCCTGGTTTAAAACTTTCAGGG - Intergenic
1072227048 10:93379985-93380007 TGCCTGGTATAAAACATTGGGGG + Exonic
1077486946 11:2843321-2843343 AGCCTGGTATGAAACATTCTAGG + Intronic
1080405875 11:31978388-31978410 TCCCTGTTATAAAAGAATGGTGG - Intronic
1086579224 11:88377912-88377934 TTCCTGGTCAAATACATTGGAGG + Intergenic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1088273616 11:108060934-108060956 TGCCTGCTATAAAACACAGCAGG - Intronic
1089770290 11:120797598-120797620 TGGCTGGCATAAAACATATGAGG - Intronic
1092541777 12:9424638-9424660 TGCCTGGAAAAACAGATTGGTGG + Intergenic
1100404504 12:94261959-94261981 TACTTGGTATAAATCATCGGAGG + Intronic
1100738191 12:97561660-97561682 TGCCTGGTTTAACTCCTTGGTGG + Intergenic
1101180695 12:102213769-102213791 TGCCTGGTATATATTATTAGAGG - Intergenic
1101835289 12:108290898-108290920 TGCTTAGAATAAAACACTGGTGG - Exonic
1102746350 12:115252128-115252150 TTCCTTTTATAAAACAGTGGGGG - Intergenic
1106899818 13:34343635-34343657 TGCATGGAAGAAAACTTTGGAGG - Intergenic
1107842135 13:44469184-44469206 TGCCTGGTTATAAAGATTGGGGG - Intronic
1110676822 13:78257976-78257998 TGCCTGTTTAAAAACATTGAAGG + Intergenic
1111638648 13:90938305-90938327 TGCCTAGTAGAAGACAGTGGAGG + Intergenic
1115164903 14:30437344-30437366 TGCCTGTTACAAAATATAGGTGG + Intergenic
1139946175 16:70643920-70643942 TTCCTGGAAAAAAAAATTGGGGG + Intronic
1140394791 16:74617331-74617353 AGCCTGGTACAAAAAATTGCTGG - Intergenic
1146691563 17:34879806-34879828 TGCCTGGTAAGAGCCATTGGAGG + Intergenic
1149360721 17:55892711-55892733 TGACTGGTATAACAGATTAGAGG - Intergenic
1149503481 17:57173180-57173202 CGCCTCTTATAAAGCATTGGTGG - Intergenic
1155802645 18:30128262-30128284 TTCCTGTTATTAAACATAGGAGG - Intergenic
1159303335 18:66606588-66606610 TATCTGGTTTAAAAAATTGGTGG - Intergenic
1162085543 19:8246859-8246881 TGTTTATTATAAAACATTGGGGG + Intronic
928605587 2:32942720-32942742 TGCCTGGAAGAAAACATGGCTGG + Intergenic
930627622 2:53716248-53716270 TGCCTGGGATAAAACTAGGGAGG + Intronic
935900318 2:107784775-107784797 TGCATGATGTAAAAAATTGGGGG + Intergenic
935985996 2:108674011-108674033 TGCCTAGTATAAAAATTTAGTGG + Intronic
936670341 2:114649188-114649210 TGCCTGTTAGAAAACCTAGGAGG + Intronic
938935319 2:136122475-136122497 TGACTGCTATAAAGCATTGATGG - Intergenic
941985175 2:171503469-171503491 TTCTTGGGATAAAACATTGAAGG - Intergenic
942739933 2:179164688-179164710 TTCCTGATGAAAAACATTGGAGG + Intronic
944755543 2:202757902-202757924 AGCCTGATGTAAAACGTTGGAGG + Intronic
946629893 2:221655758-221655780 TGCCTGGAATAAAACAGGAGGGG + Intergenic
1170458551 20:16555333-16555355 TGCCACGTATAAAACAATGCAGG + Intronic
1175568200 20:59997735-59997757 TTCCAGGAAAAAAACATTGGTGG - Intronic
1181548153 22:23616756-23616778 TTCCTGTTAAAAAATATTGGGGG - Intronic
1181548929 22:23624786-23624808 TTCCTGTTAAAAAATATTGGGGG - Intronic
1181835706 22:25606440-25606462 TGCCTGGTCTCAGGCATTGGGGG + Intronic
1183104771 22:35607980-35608002 TGCTTGGTATAAAAAATAGGAGG - Intronic
953762425 3:45700167-45700189 TGCCTAATATAAAAAAGTGGAGG + Intronic
954674644 3:52309035-52309057 TGCCTGGGGTGAAAAATTGGGGG + Intergenic
955264219 3:57425967-57425989 TGCTTGGGATAAACAATTGGAGG + Intronic
955538767 3:59952302-59952324 CACCAGGTATAAAACATAGGTGG + Intronic
957120173 3:76079963-76079985 TTCCTGCTATAAAATATTTGAGG - Intronic
962238558 3:133730470-133730492 CTCCTGGTATAGAAAATTGGTGG - Intergenic
963018508 3:140849102-140849124 TGCCTGGTAGAAAGCATTATAGG - Intergenic
963386960 3:144609655-144609677 TTCCTGGTTAAAAACATTGGAGG + Intergenic
966481468 3:180413586-180413608 TGCCTGGCATAAAAAAATGCAGG + Intergenic
968867646 4:3224072-3224094 TGCCTGATATAAATGATGGGTGG - Exonic
973054206 4:45634163-45634185 TGAATACTATAAAACATTGGTGG + Intergenic
973083215 4:46021800-46021822 TGACTGGTGTCAGACATTGGGGG - Intergenic
974292371 4:59948780-59948802 GCCCTTGAATAAAACATTGGTGG + Intergenic
974417771 4:61632595-61632617 TTCCTGGTATAAAACATCAAGGG - Intronic
978080018 4:104580884-104580906 TGCCTGGTCAAAAACATTTAGGG - Intergenic
979497282 4:121397549-121397571 TGGCTGTTATAACACATTGAAGG - Intergenic
980772334 4:137392375-137392397 TGTCTTATAGAAAACATTGGTGG + Intergenic
985360098 4:189165637-189165659 TGTCTGATATGAGACATTGGTGG + Intergenic
988140393 5:27231887-27231909 TGGCAGGTATAAAATATTTGGGG - Intergenic
992077740 5:73206719-73206741 TGCCTGGTAGCAAATGTTGGTGG + Intergenic
992421548 5:76611337-76611359 TTCCTGGTAACAAACATTGGGGG + Intronic
993560176 5:89396894-89396916 TCACTGGAATAAAACATTGATGG - Intergenic
993784340 5:92109981-92110003 TGGCTGGTATAGAAGGTTGGTGG + Intergenic
994660578 5:102649020-102649042 AGCATGGTATGAAACACTGGTGG - Intergenic
995207004 5:109491437-109491459 AGCTTGGTATAAAACTTTTGGGG + Intergenic
996749238 5:126872426-126872448 AGGCTGGCATAAAACATTGATGG + Intronic
998079075 5:139259809-139259831 TTCCTGGTCTAAAACGTAGGGGG - Intronic
998487427 5:142515186-142515208 TCACTGGTATAAAGCATTGAAGG + Intergenic
1005286224 6:24329893-24329915 TGCATGGTATGAAATACTGGAGG + Intronic
1006067459 6:31472131-31472153 TGCCTGCTATAAACTATTGGGGG + Intergenic
1006954528 6:37855979-37856001 TTCCTGACATAAAACCTTGGTGG + Intronic
1008713905 6:54265080-54265102 TGCCTGGTAGAAAATAAAGGAGG - Intronic
1009723434 6:67506132-67506154 TGCCCGGTCCAAGACATTGGTGG + Intergenic
1010852745 6:80797940-80797962 TTCCAGGTATAAAATATTGCAGG + Intergenic
1011870499 6:91886516-91886538 TGCTTGGTACAAGCCATTGGTGG - Intergenic
1015934205 6:138391911-138391933 TGCATTGTATAAAAACTTGGAGG - Intergenic
1032260609 7:130333376-130333398 TGCCTAGTATAAAAAGTTTGGGG + Intergenic
1033774931 7:144598781-144598803 ACCCTGGATTAAAACATTGGAGG + Intronic
1041941200 8:63389982-63390004 TGCCTAGTATATAACAATGTTGG - Intergenic
1044493021 8:92843113-92843135 TTCCTGATATAAAACATTGTAGG + Intergenic
1044503131 8:92985478-92985500 TTCCTGGTACAAAAAATTGGGGG + Intronic
1046197005 8:110878367-110878389 TGGCTGGAAGAAAACATGGGAGG + Intergenic
1049491283 8:142904461-142904483 TGCCTGGCAAAGAACAGTGGGGG - Intronic
1053017578 9:34671529-34671551 TTCCTGGGCTAAAACATTGAAGG + Intergenic
1054885781 9:70196930-70196952 TTTCTGGGATAATACATTGGTGG - Intronic
1055161159 9:73129691-73129713 GGCATGGTATGAAAGATTGGAGG + Intergenic
1055622690 9:78142852-78142874 TGCCTGGAATAAAACAGAAGTGG - Intergenic
1056096715 9:83262166-83262188 TGCCTGGTAAATCTCATTGGAGG - Intronic
1056319051 9:85419510-85419532 AGCATGGTATGAAAGATTGGTGG - Intergenic
1058375991 9:104322175-104322197 TCCCTACTATAAAACATTTGAGG - Intergenic
1186212046 X:7259799-7259821 TGCCTGTTAAAAAACATTCTGGG + Intronic
1186997284 X:15137503-15137525 TGCCTGAGATAAAAGATGGGAGG + Intergenic
1187574803 X:20542713-20542735 TGCATGGTAGAAACTATTGGTGG - Intergenic
1190114311 X:47616254-47616276 TGCCTGGAAGAAAAGACTGGAGG + Intronic
1190711120 X:53071273-53071295 TACCCAGTATAAGACATTGGGGG - Intronic
1192922700 X:75724208-75724230 TCCCTGGTATAAAGCACTTGGGG - Intergenic
1198056191 X:132997661-132997683 TGTCTGCTATAAAATATTTGTGG - Intergenic
1199249419 X:145642666-145642688 TGAATGGTACAAAACATTGTTGG + Intergenic
1200941277 Y:8784295-8784317 TACCCGGTAGGAAACATTGGAGG - Intergenic