ID: 1072228634

View in Genome Browser
Species Human (GRCh38)
Location 10:93393786-93393808
Sequence GATGAGAAGCAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2181
Summary {0: 1, 1: 0, 2: 11, 3: 273, 4: 1896}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072228634_1072228639 8 Left 1072228634 10:93393786-93393808 CCTTCCTCCTTCTGCTTCTCATC 0: 1
1: 0
2: 11
3: 273
4: 1896
Right 1072228639 10:93393817-93393839 CCACACTTTTACACTGTAATGGG No data
1072228634_1072228637 7 Left 1072228634 10:93393786-93393808 CCTTCCTCCTTCTGCTTCTCATC 0: 1
1: 0
2: 11
3: 273
4: 1896
Right 1072228637 10:93393816-93393838 TCCACACTTTTACACTGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072228634 Original CRISPR GATGAGAAGCAGAAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr