ID: 1072230552

View in Genome Browser
Species Human (GRCh38)
Location 10:93410832-93410854
Sequence CCTGTCAGTCATTCACATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072230550_1072230552 -10 Left 1072230550 10:93410819-93410841 CCAAGGACAGTCACCTGTCAGTC 0: 1
1: 0
2: 0
3: 10
4: 146
Right 1072230552 10:93410832-93410854 CCTGTCAGTCATTCACATCCTGG No data
1072230548_1072230552 29 Left 1072230548 10:93410780-93410802 CCTTCTCTACGATGCAAGATTAT 0: 1
1: 0
2: 0
3: 3
4: 95
Right 1072230552 10:93410832-93410854 CCTGTCAGTCATTCACATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072230552 Original CRISPR CCTGTCAGTCATTCACATCC TGG Intronic
No off target data available for this crispr