ID: 1072237287

View in Genome Browser
Species Human (GRCh38)
Location 10:93464406-93464428
Sequence CTAGTCCAACCAATAACACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072237285_1072237287 8 Left 1072237285 10:93464375-93464397 CCATTGCTTCTGCTGCTCTGGAG 0: 1
1: 1
2: 9
3: 110
4: 562
Right 1072237287 10:93464406-93464428 CTAGTCCAACCAATAACACCAGG No data
1072237284_1072237287 9 Left 1072237284 10:93464374-93464396 CCCATTGCTTCTGCTGCTCTGGA 0: 1
1: 1
2: 56
3: 563
4: 1562
Right 1072237287 10:93464406-93464428 CTAGTCCAACCAATAACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072237287 Original CRISPR CTAGTCCAACCAATAACACC AGG Intronic
No off target data available for this crispr