ID: 1072237822

View in Genome Browser
Species Human (GRCh38)
Location 10:93468405-93468427
Sequence TGGTAATGTCCCCTGTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072237822_1072237828 25 Left 1072237822 10:93468405-93468427 CCAAGACACAGGGGACATTACCA 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1072237828 10:93468453-93468475 GCTTCCTTCAGGCAAGCTTTGGG No data
1072237822_1072237826 14 Left 1072237822 10:93468405-93468427 CCAAGACACAGGGGACATTACCA 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1072237826 10:93468442-93468464 AACTATCAACTGCTTCCTTCAGG No data
1072237822_1072237829 28 Left 1072237822 10:93468405-93468427 CCAAGACACAGGGGACATTACCA 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1072237829 10:93468456-93468478 TCCTTCAGGCAAGCTTTGGGAGG No data
1072237822_1072237827 24 Left 1072237822 10:93468405-93468427 CCAAGACACAGGGGACATTACCA 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1072237827 10:93468452-93468474 TGCTTCCTTCAGGCAAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072237822 Original CRISPR TGGTAATGTCCCCTGTGTCT TGG (reversed) Intronic
900639471 1:3681837-3681859 TGTTACGATCCCCTGTGTCTGGG - Intronic
900805988 1:4768811-4768833 TGGTAATGTCCCCAGCATCCAGG + Intronic
902393433 1:16119263-16119285 TGGGCATGTCCCTTGTGTCACGG - Intergenic
902396369 1:16134263-16134285 AGGTAATGACCCCCGTGTCCCGG + Intronic
902411051 1:16211817-16211839 AGGTAATGTCCCTGCTGTCTGGG - Intronic
910718868 1:90262943-90262965 TGGTTATGCCAACTGTGTCTTGG - Intergenic
911428926 1:97758292-97758314 GGGTAATGGCCCTTGTGTGTTGG - Intronic
916704938 1:167339601-167339623 TGGTTATCTGCCCTGTGCCTGGG + Intronic
919429653 1:197476631-197476653 TTTTATTGTCCCCTGTGTCTTGG - Intronic
922758118 1:228107956-228107978 TGGTAATGTCTCCTGTGGCCCGG - Exonic
922824787 1:228510319-228510341 TCTTAATGTCCCCAGTGTCCAGG + Intergenic
923271886 1:232362962-232362984 TGGTACTAACCCCTGTTTCTAGG - Intergenic
924516306 1:244768897-244768919 TGGGCAAGTCCCCTGTGGCTAGG + Intergenic
1063275452 10:4562384-4562406 TTTCAATGTCCCCTCTGTCTTGG + Intergenic
1068431802 10:56942665-56942687 TGGTAATGTCCCCTTTACTTTGG - Intergenic
1069658408 10:70107284-70107306 TGGCAATGTCCACAGTGTCAGGG - Intronic
1072237822 10:93468405-93468427 TGGTAATGTCCCCTGTGTCTTGG - Intronic
1081645224 11:44785651-44785673 TGATAATGCTCCCTTTGTCTGGG + Intronic
1085795229 11:79533207-79533229 TTGTAATTTTCCCTGTGGCTGGG + Intergenic
1085991198 11:81846881-81846903 TGGTAATGTCTCATGTATCTAGG + Intergenic
1087312847 11:96569939-96569961 TGGTTTTGTCCCATGTGTTTGGG - Intergenic
1097806499 12:63970125-63970147 TGTTAAATTTCCCTGTGTCTTGG - Intronic
1098184122 12:67878477-67878499 TGGTAAAAGCCCCTGTGTTTGGG + Intergenic
1098514620 12:71359198-71359220 TGTTAATGTCCTCAGTGTCAAGG - Intronic
1099089753 12:78291214-78291236 TGATAAGGTTCCCTGTGACTGGG - Intergenic
1102857884 12:116310584-116310606 CGATTATGTCCCCTGAGTCTAGG + Intergenic
1108441535 13:50458009-50458031 TATTAATGTGCCCTGTGACTGGG + Intronic
1108577361 13:51801848-51801870 GGCTAATGTCCCCTCTGACTGGG - Intronic
1114752482 14:25220678-25220700 TGGCAAAGTCCACTTTGTCTTGG + Intergenic
1119837280 14:77761656-77761678 TGGTAATTTACCGAGTGTCTGGG + Intronic
1121687460 14:95847764-95847786 TGGGCTTCTCCCCTGTGTCTGGG + Intergenic
1123865666 15:24517392-24517414 TGTTAATGTTCCCTTTGTCCAGG + Intergenic
1128741123 15:70084362-70084384 TGGGATTGTCCTCTGTGTTTAGG - Intronic
1132037621 15:98500254-98500276 TGCTAATGTCCTCAGTGTCAAGG + Intronic
1132091647 15:98952240-98952262 TGGTCCTCTCCCCTGTGTCCTGG - Intronic
1137900889 16:52267664-52267686 TTGGAATGTCCCCTGGGTCCTGG - Intergenic
1139493086 16:67297572-67297594 AGGTGATGTCCCTTTTGTCTAGG + Exonic
1139649941 16:68357170-68357192 TGATGATGTCGCCTGTGTCGGGG - Exonic
1139668129 16:68472511-68472533 TGGCCATGTCACCTGTGTCCAGG - Intergenic
1139732626 16:68959677-68959699 AGGAGATGTGCCCTGTGTCTGGG - Intronic
1141149618 16:81555068-81555090 TGGGAAAGTTCCCTGTGGCTGGG - Intronic
1141450380 16:84095879-84095901 TGGTAATCCTCCCTGTGTTTAGG - Intronic
1144237641 17:13277493-13277515 TGCTACTGTCCACTGTGACTGGG - Intergenic
1146453856 17:32994771-32994793 TGCTAATGTCCTCTGTGATTTGG + Intronic
1148149616 17:45388898-45388920 TGGAAATGTTCCCTTTCTCTTGG - Intergenic
1149685294 17:58531540-58531562 TGGTACTGGCCCCTGTGCCCAGG + Intronic
1151344418 17:73492855-73492877 TGGTAATGACCCCTGCTTCCTGG - Intronic
1160141726 18:76329161-76329183 TGTTAATGACCTCTGTGTCAAGG - Intergenic
1163863489 19:19754604-19754626 TGATCATGTCCCCAGTGTCCAGG + Intergenic
1165215033 19:34264992-34265014 TGATTATGTTCCTTGTGTCTGGG + Intronic
1166328560 19:42065835-42065857 TAGTAATCTCCCCTTGGTCTGGG - Intronic
1167564799 19:50249471-50249493 TGGCTCTGTCCCCTGTCTCTGGG + Intronic
925122333 2:1428882-1428904 TGACAATGTCACTTGTGTCTGGG + Intronic
925283285 2:2699855-2699877 TGGGAGTCTCCCCTGTGGCTTGG - Intergenic
930903156 2:56532779-56532801 TGGAAATGTCCCGTGTCCCTTGG - Intergenic
930971739 2:57404443-57404465 TTCTAATCTCCCCTTTGTCTAGG - Intergenic
931395935 2:61888507-61888529 TGGCAAACTCCGCTGTGTCTGGG + Exonic
932028176 2:68156906-68156928 TGGTAATGTCCCCCATCTCATGG - Intronic
932031785 2:68195181-68195203 TTGTAATTTCTCCTGAGTCTTGG + Intronic
939278874 2:140037498-140037520 TGTTATTGTCCCATGTTTCTTGG - Intergenic
941727252 2:168874991-168875013 TGGCAATGTCTGTTGTGTCTGGG - Intronic
942771207 2:179523459-179523481 TGTTTATTTTCCCTGTGTCTAGG - Intronic
944451603 2:199849905-199849927 AGGTAATGTTCCCTGTGTGAGGG + Intronic
948147257 2:235716946-235716968 TGGCACTGTCCCCTTTTTCTCGG + Intronic
948684971 2:239664613-239664635 TGGAACTGTCCCCTGTGCCCCGG + Intergenic
1169182243 20:3579851-3579873 TGGAAATGTGGCCTGGGTCTCGG + Intronic
1170874472 20:20237293-20237315 TCGTAAGGTACCCTGAGTCTGGG - Intronic
1173644978 20:44627624-44627646 TGGCAAGGACCCCTCTGTCTTGG + Intronic
1174437074 20:50516318-50516340 TTCTAGTGTCCCCTGTGTCTGGG + Intronic
1175845527 20:62056546-62056568 TGGTAACGGCCCCTGTGCCAGGG - Intronic
1176258893 20:64168703-64168725 TGGATATGTTCCCTGTGCCTTGG + Intronic
1178776568 21:35557081-35557103 TGAGAATATCCCCTGTGCCTAGG - Intronic
1178962597 21:37080904-37080926 TGGTTATGTTCCAGGTGTCTTGG + Intronic
1179794555 21:43775432-43775454 TGGCAACCTTCCCTGTGTCTCGG - Intronic
1182026795 22:27125631-27125653 AGGTGAGGTCTCCTGTGTCTTGG - Intergenic
1184894264 22:47397915-47397937 GGGTAATGTCCCCTGCCTCCTGG + Intergenic
1184924599 22:47628014-47628036 TGGTAGTGTCGCCTGTCCCTCGG - Intergenic
952474596 3:33694652-33694674 TTGTAGTTTCTCCTGTGTCTAGG - Intronic
952933378 3:38376570-38376592 AGGAAAAGTCCCCAGTGTCTGGG + Intronic
952990526 3:38827428-38827450 TGGGCATGTCCACTGTGACTGGG - Intergenic
958735998 3:98010333-98010355 TGATAATGTCCCCAGGGTGTTGG - Intronic
962714300 3:138114142-138114164 TGGCAATGTCTCCTGTCCCTAGG - Intronic
962714767 3:138116316-138116338 TGGCAATGTCTCCTGTCCCTAGG + Intergenic
963103402 3:141625582-141625604 TGGCACAGTGCCCTGTGTCTGGG - Intergenic
971039522 4:22735997-22736019 TGGAAAAGGCCCTTGTGTCTGGG + Intergenic
972284368 4:37634215-37634237 TGGTGCTTTCCACTGTGTCTTGG - Intronic
978343880 4:107745565-107745587 TGGTAATTTGCCCTATCTCTTGG + Intergenic
983979110 4:173972817-173972839 TGGTAATGGCACCTGGGTTTAGG + Intergenic
987415159 5:17654772-17654794 TTGCAATGTTCCCTGTGTCATGG - Intergenic
987631373 5:20477592-20477614 TGGGAGAGTCCCCTCTGTCTAGG - Intronic
989566304 5:42904628-42904650 GGGTACTGTGACCTGTGTCTTGG - Intergenic
989566998 5:42910744-42910766 GGGTATTGTGACCTGTGTCTTGG + Intergenic
990036232 5:51323738-51323760 TGGAAAAGTCCCCTTTATCTAGG - Intergenic
995220902 5:109646715-109646737 TGCTAATGTGCCCTGTGTATAGG + Intergenic
997787219 5:136724488-136724510 GGATAATTTCCCCTGTATCTTGG + Intergenic
999579493 5:153020468-153020490 TGGCAATGGCACCAGTGTCTGGG - Intergenic
1001847946 5:174938080-174938102 TGGGATTGTCCCCTGTGGCCTGG - Intergenic
1006420056 6:33927436-33927458 TGTTAGTGTTCCCTGTGTTTGGG - Intergenic
1007184736 6:39959586-39959608 TGGTCTTGTCACCTTTGTCTTGG + Intergenic
1012739662 6:103000337-103000359 TGGAAATTTCCCTTATGTCTGGG + Intergenic
1015123575 6:129727866-129727888 TAATAATGTCTCCAGTGTCTAGG - Intergenic
1016983711 6:149877734-149877756 TGGGAATGTCCCCTCTCTCAAGG + Intergenic
1017945965 6:159096637-159096659 TGGTCCTCTACCCTGTGTCTGGG + Intergenic
1018989889 6:168666463-168666485 GGGAAATTTCCCATGTGTCTAGG - Exonic
1020530247 7:9324032-9324054 AAGTAAGGTCACCTGTGTCTTGG - Intergenic
1022762071 7:33365714-33365736 TGGTAATGGCACCAGTGCCTGGG + Intronic
1023707173 7:42953348-42953370 TGGTAAGGTCCGCTGTATCCTGG - Intergenic
1023887411 7:44368876-44368898 TGTTAATGTCCTCAGTGTCAAGG - Intergenic
1028511538 7:91630484-91630506 TGGTATTTTCTCCTGAGTCTTGG + Intergenic
1029141919 7:98417439-98417461 TGATAACATCCCCTGTGACTTGG + Intergenic
1030827454 7:114176950-114176972 TGGTATAGTCTTCTGTGTCTGGG + Intronic
1031301953 7:120070569-120070591 TGTTAATGTCCTCAGTGTCAAGG - Intergenic
1031582454 7:123493182-123493204 TGGAAATGTTCCCTGTGTTTGGG - Intronic
1033116615 7:138631497-138631519 TGGGAATGTGCCGTGGGTCTTGG - Intronic
1034190039 7:149207006-149207028 TGGTAATGGGCCCTGTTACTGGG - Intronic
1037987079 8:23296716-23296738 AGGGGAAGTCCCCTGTGTCTGGG + Intergenic
1040531528 8:48270296-48270318 TGGTTTTGTCCCCTGTTCCTTGG + Intergenic
1042017909 8:64337665-64337687 AGGCAATGTCCCCTATATCTAGG + Intergenic
1043778387 8:84299806-84299828 TGGTAATGTCCCCTTTGTGATGG + Intronic
1050291329 9:4158361-4158383 TGTTACTGTCCCCTCTGTCACGG + Intronic
1051770039 9:20567691-20567713 TGGACATGTACCCTGTGTCTTGG - Intronic
1052343982 9:27389844-27389866 TGGTGATGTCTCCTCGGTCTCGG - Intronic
1053069762 9:35094240-35094262 TGCCATTGTCCACTGTGTCTAGG + Exonic
1055276723 9:74625519-74625541 TGGGAGTATCCCCTGAGTCTGGG + Intronic
1060905921 9:127305490-127305512 GGGTTATTTCCCCTGTGTTTTGG + Intronic
1060991261 9:127850496-127850518 TGGTCACGTCCCCCGTGTCTCGG + Intronic
1192381158 X:70618118-70618140 TGGTAAAAGCCCCTGTGTTTGGG + Intronic
1194806355 X:98333224-98333246 TGCTAATTCCCCCTCTGTCTTGG + Intergenic
1196848127 X:119912923-119912945 TTGGAATGTCTCCTTTGTCTGGG - Intronic
1197063158 X:122206643-122206665 TGAAAATGTCCCCTGTGTTAAGG - Intergenic