ID: 1072243193

View in Genome Browser
Species Human (GRCh38)
Location 10:93516914-93516936
Sequence ACCTATGACAAACAACATTA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072243193_1072243194 20 Left 1072243193 10:93516914-93516936 CCGTAATGTTGTTTGTCATAGGT 0: 1
1: 0
2: 0
3: 7
4: 136
Right 1072243194 10:93516957-93516979 GAAATGTTACAACGATCTCTTGG 0: 1
1: 0
2: 0
3: 8
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072243193 Original CRISPR ACCTATGACAAACAACATTA CGG (reversed) Exonic
903103807 1:21056097-21056119 ACCAATGAAAAACAACTTTCAGG + Intronic
903466176 1:23554151-23554173 GCCTTTGACAAACCAGATTAAGG - Intergenic
911984739 1:104608086-104608108 AGCTATTACGAAAAACATTATGG + Intergenic
912000478 1:104828099-104828121 ACCTATTAAAAAATACATTATGG + Intergenic
912105788 1:106272853-106272875 ACCTAGAACAAACAAAAATAGGG - Intergenic
915734206 1:158074536-158074558 CCCTGTGACAAACAAAATCATGG + Intronic
916296364 1:163224615-163224637 AGCCATTACAAACAACAGTATGG - Intronic
918175701 1:182043160-182043182 ACCTACGACCAACATCATAATGG - Intergenic
920194871 1:204220132-204220154 GCCTATGCCAAACAGCACTAAGG - Exonic
1063136809 10:3224403-3224425 ACCAATCACCAACACCATTATGG - Intergenic
1063355611 10:5395724-5395746 ACCAATGACAACAAACATCATGG + Intronic
1063861988 10:10320378-10320400 ATCTAAGGCATACAACATTACGG - Intergenic
1066448403 10:35505330-35505352 ACCTATGGCAAACAAGACAAAGG - Intronic
1068000236 10:51324952-51324974 AGCTATTACAGAAAACATTATGG - Intronic
1070537025 10:77386873-77386895 AGCTAAGAGAAAGAACATTAAGG + Intronic
1072243193 10:93516914-93516936 ACCTATGACAAACAACATTACGG - Exonic
1072865486 10:99056161-99056183 AACTATTATAAACAACTTTATGG + Intronic
1078882347 11:15464557-15464579 ACTGATGCCAAACAACAATACGG - Intergenic
1079582138 11:22078988-22079010 ACCTCAGACAAACAAGATCATGG - Intergenic
1085357915 11:75856302-75856324 AACTATGAAAAACAAACTTAAGG - Intronic
1086888838 11:92232778-92232800 ACCTCTGAAAAACAACAATTGGG + Intergenic
1087282478 11:96227323-96227345 AACTATGAAAAGCAATATTAAGG - Intronic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1094569604 12:31629986-31630008 ACCTCTGACAAACAATGATATGG + Intergenic
1096402208 12:51316650-51316672 ATCTATGACAAGCAACAGTGTGG - Intronic
1103521524 12:121539178-121539200 CCCTAAGACAACCAACATAATGG + Intronic
1105765101 13:23551555-23551577 AGCTATGACAAACAAATTTTAGG + Intergenic
1106761752 13:32874832-32874854 ATGTGTGACAAACAACAGTATGG + Intergenic
1107008268 13:35639882-35639904 AGCCATGACAAACAGCATGAAGG - Intronic
1109186700 13:59277821-59277843 ACATATGACACACAGCAGTAAGG + Intergenic
1109314797 13:60737553-60737575 ACATAAAACAAACACCATTAGGG - Intergenic
1113167858 13:107463187-107463209 TCCTATGTCAAAAAACATTTAGG - Intronic
1115814639 14:37150228-37150250 AACTTTGAAAAACAAAATTATGG + Intronic
1116183827 14:41570167-41570189 TCAAATGAAAAACAACATTAGGG - Intergenic
1117267809 14:54108436-54108458 ACATATTAAAAACAACATTTAGG - Intergenic
1120333932 14:83129233-83129255 ACCTTTGACAGAAAACTTTAAGG - Intergenic
1120870581 14:89333443-89333465 ACCTATTACGAAGAACAGTATGG + Intronic
1123987844 15:25660475-25660497 ACCTATGAAAAAAAACAGGAAGG + Intergenic
1125458212 15:39882660-39882682 ACAGATGACACACAACAATATGG + Intronic
1127680649 15:61294061-61294083 ACCTATGAGGAACAACATCCAGG + Intergenic
1128636033 15:69302996-69303018 ACAGATGGCAAACAAGATTAAGG - Intronic
1128896854 15:71382190-71382212 ACCTAAGAAAGACAACATGAAGG + Intronic
1132325198 15:100963244-100963266 ACCTATGACAATGAAGACTAAGG - Intronic
1142523579 17:521909-521931 ACCTAGGAGAAACAACATCAAGG + Intronic
1151637095 17:75357416-75357438 ACCTATTACTAACATTATTATGG - Intronic
1156654518 18:39269320-39269342 AAATCTCACAAACAACATTAAGG + Intergenic
1156668293 18:39435532-39435554 ACCTAAGACAAACAAAAAAATGG + Intergenic
1156825179 18:41422204-41422226 ACCTATGAAAAGCAACTTTCAGG - Intergenic
1157981501 18:52386897-52386919 ACCTATTACAGATACCATTACGG + Intronic
1159297424 18:66513031-66513053 GCCTATGACTAACAATATTCAGG - Intronic
1159318537 18:66813787-66813809 ACCTATGACAAAAAACTTTCGGG - Intergenic
1162616206 19:11802628-11802650 ACCCATGACCAAAACCATTATGG - Intronic
1167103487 19:47418108-47418130 ACCCAAGAGAAACACCATTATGG + Intronic
929469080 2:42173062-42173084 ATCTATAAGAAACAACATTCTGG + Intronic
930339926 2:50099239-50099261 ACCTATTAAAAACAACTTTAGGG + Intronic
930592384 2:53343426-53343448 AGCCATTATAAACAACATTATGG + Intergenic
933221834 2:79699448-79699470 ACTTATTATAAACAATATTATGG + Intronic
935871915 2:107460122-107460144 ACAGAAGACATACAACATTATGG - Intergenic
936869609 2:117119481-117119503 AACTATTAAAAACAACATTGGGG - Intergenic
937289395 2:120773111-120773133 TCCTGTGACAAACAACTTTGTGG + Intronic
938935025 2:136119636-136119658 ACCTTTAACCACCAACATTAGGG - Intergenic
939035291 2:137123315-137123337 ACCAATGAGAAACAAGATTCAGG + Intronic
939483121 2:142774422-142774444 ACCTAAAATAAACAACATAATGG - Intergenic
940180337 2:150924672-150924694 AGCTTTGACCAAGAACATTATGG - Intergenic
941321642 2:164063079-164063101 AACTATGGCCAGCAACATTATGG + Intergenic
941383907 2:164829931-164829953 ACCTATGTCAAACATTCTTATGG - Intronic
943204377 2:184873950-184873972 ACCTATTAGAATTAACATTAGGG - Intronic
945973954 2:216256507-216256529 ACCAAAGAAAAACAACATCATGG + Intergenic
947445541 2:230160066-230160088 ACTTGTGACAAACAACAGAAGGG + Intergenic
947821360 2:233073241-233073263 ACCTGTGACAAACAGAATCAAGG - Intronic
1169759001 20:9070516-9070538 TCCTATGAAAAACAGCATTCTGG - Intronic
1174965775 20:55213036-55213058 ACGAATGACAAAGAACATTTAGG - Intergenic
1178228061 21:30747481-30747503 AACTATGGAAAACAAAATTATGG - Intergenic
1178446008 21:32643167-32643189 ACAGAGTACAAACAACATTAAGG + Intronic
1184408732 22:44314456-44314478 ACCTATGACATAGAAAAGTATGG + Intergenic
951943764 3:28111468-28111490 ACCTATGACAAAGAATTATATGG - Intergenic
953087736 3:39688278-39688300 AACTATTACCAAAAACATTAGGG + Intergenic
954495839 3:50960538-50960560 AACTAAGACAAACAACCTAATGG - Intronic
955568324 3:60273997-60274019 AACTATGACAAATTACATTTTGG + Intronic
960442654 3:117708060-117708082 ACCAATCACAAACAACCTTTTGG - Intergenic
963820141 3:149882103-149882125 ACATATGACACTTAACATTAAGG + Intronic
964123824 3:153215317-153215339 ACCCAAGACAAAGAAGATTATGG - Intergenic
964296834 3:155242430-155242452 GCCTATGCCAACCAACATTAAGG + Intergenic
966235733 3:177700158-177700180 GCCTATGAAAGACAAAATTATGG - Intergenic
967744600 3:193041145-193041167 ACATAAGACAAACAAGAATAAGG + Intergenic
972953882 4:44365300-44365322 AACTATGTCTAACAACATCAAGG + Intronic
977710940 4:100124481-100124503 ACCTCTGAAAAACAAAAATAAGG - Intergenic
977902278 4:102436388-102436410 AGCTATTACAAAAAACAGTATGG + Intergenic
979323863 4:119356179-119356201 AACTACTACAAACAACATTCAGG - Intergenic
983174800 4:164575950-164575972 ACATATGAGAAACCACATTCAGG + Intergenic
983241703 4:165240856-165240878 AACTACTACAAACAACATTCAGG - Intronic
985158032 4:187013494-187013516 AGTCATGCCAAACAACATTATGG - Intergenic
989236844 5:39158028-39158050 ACTAATGACAAAAAAAATTAAGG + Intronic
989331463 5:40264173-40264195 ACATATTACAAACTACATAATGG - Intergenic
989701708 5:44274075-44274097 GCTAATGATAAACAACATTAAGG - Intergenic
989712877 5:44422298-44422320 AGCTATGACAATCAACGTTCAGG + Intergenic
992162812 5:74018921-74018943 GCCTATGAAAAACAACCATATGG + Intergenic
993845169 5:92932755-92932777 ACCTAGGATAAACAGCCTTAAGG + Intergenic
994621399 5:102167115-102167137 AACACTGACAAATAACATTAAGG + Intergenic
994906712 5:105848891-105848913 AACAATGACAATAAACATTATGG - Intergenic
997154372 5:131537511-131537533 TCCTATTACAAACAACTTTTAGG - Intronic
1000249584 5:159481354-159481376 ACCTGTGAGAAACAATATTAGGG + Intergenic
1000890586 5:166797037-166797059 ACCTCAGACCAACAACAGTATGG - Intergenic
1000944659 5:167405950-167405972 GCCTATGATAAACAACACTTTGG - Intronic
1000997804 5:167976184-167976206 ACCTATGAAAATAACCATTATGG + Intronic
1004349172 6:14876091-14876113 ACCTCTGACAAACAACAGGGTGG + Intergenic
1008046137 6:46853484-46853506 AATAAAGACAAACAACATTAAGG - Exonic
1009513584 6:64584209-64584231 AAATATTAAAAACAACATTAAGG + Intronic
1011989898 6:93501500-93501522 ACCTTTGCCATACAGCATTATGG - Intergenic
1013969443 6:115999231-115999253 ACCAATGACAAATAAGAGTAAGG + Intronic
1016227327 6:141754759-141754781 ACTTATGAGAAATAAAATTAAGG + Intergenic
1018083421 6:160278336-160278358 ACCTATCACAAACACCATCCTGG - Intergenic
1020954321 7:14720928-14720950 ACTTATGATAAAAAACATTTTGG + Intronic
1022831358 7:34070343-34070365 AAGTATGAGAAATAACATTAAGG - Intronic
1024712239 7:52029141-52029163 AACTATGACATCCAACATGAGGG + Intergenic
1028560938 7:92175216-92175238 AAATATGGCAAAAAACATTATGG - Intronic
1033628125 7:143131064-143131086 ACCTATGACTTACAATACTATGG - Intergenic
1035248605 7:157581699-157581721 ACCTGTAACAAACAACAATATGG - Intronic
1038881841 8:31623137-31623159 ACCTTTAACAAACAAGAATAGGG + Intergenic
1041007724 8:53511535-53511557 CCCCATGACAACCAACATTTAGG - Intergenic
1042522089 8:69724213-69724235 ACCTATTTCAAACAAATTTAAGG + Intronic
1043167637 8:76924201-76924223 ACCTAGCACCATCAACATTAAGG - Intergenic
1043649194 8:82567141-82567163 ACTCATGAAAAACAACAGTAAGG - Intergenic
1044372657 8:91430994-91431016 ACATATGACAAATAAGATTAGGG - Intergenic
1044940668 8:97339425-97339447 AGCTATGACTAACAACCTAATGG + Intergenic
1047980856 8:130180483-130180505 ACCACTCACAAGCAACATTAAGG + Intronic
1051122780 9:13770022-13770044 ATGTTTGACAAACAACATAAAGG + Intergenic
1051961333 9:22767340-22767362 AGCTATGAATCACAACATTAAGG + Intergenic
1054838370 9:69705764-69705786 ACCTGTGACAAAAAAAAATATGG - Intergenic
1058176666 9:101743152-101743174 AGCTATGAAAAAGCACATTATGG + Intergenic
1059113262 9:111577207-111577229 CCCTATGGCTAACAATATTAAGG - Intronic
1061748930 9:132761643-132761665 AAATATTACAAACAACTTTATGG - Intronic
1185962542 X:4561161-4561183 ACCTTTAAAACACAACATTATGG - Intergenic
1186630901 X:11347901-11347923 AACTATGACAAACTACAGAATGG + Intronic
1186841623 X:13489948-13489970 GCCTATGTTAATCAACATTAAGG + Intergenic
1186924801 X:14321887-14321909 ACCTCTGACCTACAGCATTATGG + Intergenic
1187788193 X:22917494-22917516 ACCTATGGCAATCAAAATCAAGG - Intergenic
1188385942 X:29558109-29558131 AACTATTACAAAAAACATAATGG - Intronic
1190472737 X:50799144-50799166 ACTTAATACAAACAACAGTAAGG + Intronic
1194669429 X:96712214-96712236 ACATCTGAAAAATAACATTAGGG - Intronic
1195948159 X:110237743-110237765 AACTTTGGTAAACAACATTAAGG + Intronic
1198124489 X:133629085-133629107 ACCTATGAGAAATCACATTCTGG + Intronic
1198675391 X:139125515-139125537 AACTAAGACATACAACTTTATGG - Intronic
1201753033 Y:17455065-17455087 ACCTTTAAAACACAACATTATGG - Intergenic