ID: 1072245858

View in Genome Browser
Species Human (GRCh38)
Location 10:93543212-93543234
Sequence CAGTGTTACCATCTGCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072245858_1072245862 5 Left 1072245858 10:93543212-93543234 CCTGCCTGCAGATGGTAACACTG No data
Right 1072245862 10:93543240-93543262 AAGTGGTAACACCCAAATAAGGG No data
1072245858_1072245867 30 Left 1072245858 10:93543212-93543234 CCTGCCTGCAGATGGTAACACTG No data
Right 1072245867 10:93543265-93543287 AAAGATCAAGACCAAGCTAGGGG No data
1072245858_1072245866 29 Left 1072245858 10:93543212-93543234 CCTGCCTGCAGATGGTAACACTG No data
Right 1072245866 10:93543264-93543286 GAAAGATCAAGACCAAGCTAGGG No data
1072245858_1072245865 28 Left 1072245858 10:93543212-93543234 CCTGCCTGCAGATGGTAACACTG No data
Right 1072245865 10:93543263-93543285 TGAAAGATCAAGACCAAGCTAGG No data
1072245858_1072245861 4 Left 1072245858 10:93543212-93543234 CCTGCCTGCAGATGGTAACACTG No data
Right 1072245861 10:93543239-93543261 TAAGTGGTAACACCCAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072245858 Original CRISPR CAGTGTTACCATCTGCAGGC AGG (reversed) Intergenic
No off target data available for this crispr