ID: 1072251777

View in Genome Browser
Species Human (GRCh38)
Location 10:93587371-93587393
Sequence CTGGATCAGGATGAGGAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 702
Summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 635}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072251777_1072251786 23 Left 1072251777 10:93587371-93587393 CCATCCTCCTCATCCTGATCCAG 0: 1
1: 0
2: 5
3: 61
4: 635
Right 1072251786 10:93587417-93587439 CTGGCCGTCCCTCTTCTTCTGGG 0: 1
1: 0
2: 1
3: 17
4: 203
1072251777_1072251782 -4 Left 1072251777 10:93587371-93587393 CCATCCTCCTCATCCTGATCCAG 0: 1
1: 0
2: 5
3: 61
4: 635
Right 1072251782 10:93587390-93587412 CCAGAACTTCAAGCAAGACCTGG 0: 1
1: 0
2: 1
3: 18
4: 192
1072251777_1072251785 22 Left 1072251777 10:93587371-93587393 CCATCCTCCTCATCCTGATCCAG 0: 1
1: 0
2: 5
3: 61
4: 635
Right 1072251785 10:93587416-93587438 TCTGGCCGTCCCTCTTCTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 157
1072251777_1072251789 29 Left 1072251777 10:93587371-93587393 CCATCCTCCTCATCCTGATCCAG 0: 1
1: 0
2: 5
3: 61
4: 635
Right 1072251789 10:93587423-93587445 GTCCCTCTTCTTCTGGGTGGTGG 0: 1
1: 0
2: 3
3: 23
4: 264
1072251777_1072251787 26 Left 1072251777 10:93587371-93587393 CCATCCTCCTCATCCTGATCCAG 0: 1
1: 0
2: 5
3: 61
4: 635
Right 1072251787 10:93587420-93587442 GCCGTCCCTCTTCTTCTGGGTGG 0: 1
1: 0
2: 0
3: 9
4: 147
1072251777_1072251783 4 Left 1072251777 10:93587371-93587393 CCATCCTCCTCATCCTGATCCAG 0: 1
1: 0
2: 5
3: 61
4: 635
Right 1072251783 10:93587398-93587420 TCAAGCAAGACCTGGTCATCTGG 0: 1
1: 0
2: 0
3: 5
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072251777 Original CRISPR CTGGATCAGGATGAGGAGGA TGG (reversed) Exonic
900100512 1:960276-960298 CCGGAGGAGGAGGAGGAGGAGGG + Intergenic
900499847 1:2998652-2998674 CTGGAGCAGGAGGAGGGGCAGGG + Intergenic
900785422 1:4646759-4646781 CTGGAACATGCTGGGGAGGAAGG - Intergenic
901059186 1:6464276-6464298 CTGGTTCAGGAATAGGAAGAGGG - Intronic
901235327 1:7664559-7664581 CTGGAACTGCATGAGGTGGAGGG - Exonic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
901421546 1:9154538-9154560 CTGACTCAGGAGGAAGAGGAAGG - Intergenic
901864858 1:12098851-12098873 CAGGAAGAGGATGAGGAGGTGGG - Intronic
902439687 1:16421434-16421456 GGGGATCAGGAGGAGGAAGAGGG - Intronic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
902682975 1:18056770-18056792 CTGGGCCAGGATTAGGAGGGAGG + Intergenic
902718688 1:18290182-18290204 GTGGAGGAAGATGAGGAGGACGG - Intronic
902821790 1:18947891-18947913 CTGGCTCAGGGTGAGGAGGCAGG - Intronic
903364701 1:22798836-22798858 CAGGAGCAGGATGAGAAGGGAGG + Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903557524 1:24204409-24204431 CAGACTCAGAATGAGGAGGAAGG - Intergenic
903864758 1:26389912-26389934 TAGGAGCAGAATGAGGAGGAAGG + Intergenic
904037482 1:27566679-27566701 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
904295184 1:29515711-29515733 GAGGAGCAGGAGGAGGAGGAGGG - Intergenic
904482074 1:30800414-30800436 CTGGAGCAGAGTGAGGAGGAAGG + Intergenic
904565471 1:31425803-31425825 CTGGATGAGGATGAAGAGGAAGG - Exonic
905205600 1:36341261-36341283 CTGGATCAGAAAGAGAGGGACGG + Exonic
905344505 1:37302253-37302275 CTAGAGCAGGATGAGAAGGAGGG + Intergenic
905460283 1:38118374-38118396 CTGTCTCAGGGTGAGCAGGATGG + Intergenic
906261747 1:44397073-44397095 CTGGAGAAGGATGTGGATGAAGG + Intergenic
910895051 1:92060373-92060395 CTGCATCATGATGATGATGATGG + Intronic
911181779 1:94867308-94867330 CTGGATCAGGTTGAGAACAAAGG - Intronic
912179972 1:107208021-107208043 CACGATCATGATGAAGAGGAGGG - Intronic
912431986 1:109632842-109632864 CTGGAGCAGGAGGGGGAGGCTGG + Intergenic
912993435 1:114510928-114510950 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
913175369 1:116268217-116268239 CTGGCCAAGGCTGAGGAGGAGGG - Intergenic
913392181 1:118326557-118326579 ATGGATCAGGCAGAGGAGTAGGG - Intergenic
914923516 1:151863932-151863954 CTGGAGAAGGCAGAGGAGGAAGG - Intergenic
914960160 1:152197907-152197929 GAGGATCATGAAGAGGAGGAGGG - Intergenic
915072426 1:153281617-153281639 TTGGATGTGGATGAAGAGGAAGG + Intergenic
915240738 1:154519788-154519810 GCGGAGCAGGATGGGGAGGAGGG + Intronic
915248854 1:154574378-154574400 CTGGATTAGGATGAGGGTGGGGG - Intronic
915313632 1:155016617-155016639 CCTGATGACGATGAGGAGGAAGG + Exonic
915457213 1:156048744-156048766 CTGTATCAGGATCAGGACCAGGG + Intronic
915553817 1:156650237-156650259 CTGGATCATGAGGAGGGGCAGGG + Intronic
917169657 1:172157013-172157035 ACAGATCAGGATGAGGTGGATGG + Intronic
917383815 1:174446084-174446106 CAGGATGAGGAGGAGGAGTAGGG + Intronic
917526912 1:175796302-175796324 CTGGGTCAGGGTGGGGAGGTGGG - Intergenic
919721397 1:200840505-200840527 CTTGAGGAGGCTGAGGAGGAAGG - Intronic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920338394 1:205259894-205259916 CTGGAGCAGGAAGAGGAATAGGG + Intronic
920382670 1:205544601-205544623 TTGAATTAGGATGAGGAAGAGGG - Intergenic
920805304 1:209228231-209228253 CTATATCTGGATGAGAAGGAGGG + Intergenic
921159563 1:212463544-212463566 CTGGGTCAGGTAGAGGATGAGGG - Intergenic
921264488 1:213411029-213411051 CAGGACCAGGATGGAGAGGAAGG + Intergenic
921887521 1:220321621-220321643 ATGGAGGAGGAAGAGGAGGAAGG + Intergenic
922203031 1:223422741-223422763 CTGGATCAGGAAGGAAAGGAAGG + Intergenic
922241005 1:223755524-223755546 GAGGATGAGGACGAGGAGGATGG + Exonic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
923069020 1:230545880-230545902 CTAGAAAAGGTTGAGGAGGAGGG + Intergenic
923987271 1:239395353-239395375 GGGGAACAGGATGAGGAAGAAGG - Intronic
924481176 1:244435656-244435678 ATGGAGGAGGAAGAGGAGGATGG - Intronic
924585830 1:245360312-245360334 TGGGATGAGGATAAGGAGGATGG - Intronic
924907630 1:248473493-248473515 GTGGATGAGGAGGATGAGGAGGG - Exonic
924911997 1:248523048-248523070 CTGCACAAGGATGAGAAGGATGG - Intergenic
924916479 1:248574593-248574615 GTGGATGAGGAGGATGAGGAGGG + Exonic
1063159443 10:3408707-3408729 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063159481 10:3408849-3408871 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063438121 10:6050787-6050809 CAGGACGAGGAGGAGGAGGATGG + Intronic
1063487449 10:6433247-6433269 ATCCATCAGGATGAGGGGGAAGG - Intronic
1063640488 10:7825415-7825437 CTGGAGAAGGATGGGGATGATGG - Intronic
1063653945 10:7968265-7968287 CTTGGTCAGGATGATGAGAAGGG - Intronic
1064615267 10:17147482-17147504 CTGGAGGTGGATGGGGAGGATGG - Exonic
1064633967 10:17345088-17345110 CTGCAGCAGGGGGAGGAGGAGGG + Intronic
1065512836 10:26496324-26496346 GTGGATTAGGGTCAGGAGGAGGG - Exonic
1065920980 10:30392608-30392630 CAGGATCAGGGTGGGGAGGCAGG + Intergenic
1067278292 10:44853195-44853217 CTGGTTCAGGATCACAAGGAAGG - Intergenic
1067748243 10:48952664-48952686 CTGCATTAGGAGGAGGAGGGTGG - Intronic
1068022196 10:51598946-51598968 CTGAAACAGGAAGAGGAAGAGGG + Intronic
1069548206 10:69343804-69343826 CTGGAGGGGGATGAGAAGGAAGG - Intronic
1069995266 10:72338112-72338134 CTGGATCAGGATGGGAAAGAAGG + Intronic
1070158131 10:73848952-73848974 GCAGATCAGGAAGAGGAGGAAGG + Intronic
1070164385 10:73886942-73886964 CTGGAGAAGGAAGAGCAGGAAGG - Intergenic
1070331045 10:75417574-75417596 CTGGCTCAGAGTGAGGAGGGAGG - Intergenic
1070379722 10:75869777-75869799 CTGGATCAAGAAGAGGCAGATGG - Intronic
1071257877 10:83889531-83889553 ATGGGTCAGGAAGAGGAGTAGGG - Intergenic
1071306573 10:84304321-84304343 CTGTACCAGGAAGAGAAGGATGG - Intergenic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1072276511 10:93828582-93828604 CTAGATCAGGCTGAGAAAGAAGG - Intergenic
1072428050 10:95347039-95347061 CTTGATCAGGAAGTGGAGAAGGG - Intronic
1072448036 10:95516288-95516310 CTGGATCAGAATGACCTGGAAGG - Intronic
1072563150 10:96595591-96595613 GTGGAACAGGTGGAGGAGGATGG + Exonic
1072619040 10:97067809-97067831 CTGGCCCAGGAGGAGGAGGTGGG - Intronic
1073140943 10:101247272-101247294 CTGGAGCAGGGTGGGCAGGATGG + Intergenic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073359659 10:102887849-102887871 CTGGAAAAAGAAGAGGAGGAAGG - Intronic
1073420686 10:103421499-103421521 CTGATTCAGGAGGAGGAGGCTGG - Exonic
1073448184 10:103593297-103593319 CTGGAACAGGATGGGCAGGCAGG - Intergenic
1073540944 10:104315825-104315847 CTGGAGCAGGTGGCGGAGGAGGG - Exonic
1073548609 10:104376025-104376047 CTGGATCTGGAAGGGAAGGAAGG + Intronic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1075099182 10:119493973-119493995 CTAGATGAAGATGAGGAGCAGGG + Intergenic
1075226426 10:120633685-120633707 CTGCCTGAGGGTGAGGAGGAAGG + Intergenic
1075866451 10:125725108-125725130 CTGGCTTAGGAGGAGGAAGACGG + Intronic
1076343023 10:129762612-129762634 CTGTCTGAGGATGAAGAGGAAGG - Intronic
1076538586 10:131198986-131199008 CTGGGTCAGAATGAGGGGAATGG + Intronic
1076601286 10:131658568-131658590 CTCGAGCAGGGTGAGGAGGAAGG + Intergenic
1077023202 11:428728-428750 CAGGGTCAGGACGAGGATGACGG + Exonic
1077357339 11:2124535-2124557 CTGCAGCAGGAAGAGGTGGAGGG - Intergenic
1077634373 11:3832032-3832054 CTGGAAAAGGATGATGAGTATGG + Intronic
1077768525 11:5189348-5189370 CTGGAGCAGGAAGAAGAGGCAGG - Intergenic
1077807655 11:5605430-5605452 CTGGAACAGGAAGAGAAGAAGGG + Exonic
1079079984 11:17407353-17407375 CAGGATGAGGAAGAGGAGGAAGG - Exonic
1079243006 11:18733803-18733825 AGGACTCAGGATGAGGAGGAGGG + Intronic
1081303044 11:41477024-41477046 CTGTTACAGAATGAGGAGGAGGG + Intergenic
1081598316 11:44474560-44474582 CAGGATTAGGACCAGGAGGATGG + Intergenic
1081659552 11:44879641-44879663 CTGGAACAGGGTGAGGAGGGTGG + Intronic
1082273841 11:50200451-50200473 CTGTGTCAGGATGAGGAGATTGG - Intergenic
1083928141 11:65821598-65821620 CTGGCTCAGGAACTGGAGGAAGG - Intergenic
1083988610 11:66233039-66233061 CTGGATCCGGGTGAGCAGGGCGG - Exonic
1084067696 11:66714794-66714816 CTGGGGCATGAGGAGGAGGAGGG + Intronic
1084145209 11:67261600-67261622 CGGGATGAGGATGAGGATGAGGG + Intergenic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1084968576 11:72757175-72757197 CTGGATTTGGCTGAGGAAGAGGG + Intronic
1085011011 11:73141920-73141942 AAGGACCAGGAGGAGGAGGAGGG + Exonic
1085462390 11:76701990-76702012 CTGGATCAGAACGAGGAGAAGGG + Intergenic
1085768145 11:79301799-79301821 CTGGAGCAGGAGGAAGAAGAGGG - Intronic
1086185846 11:84014812-84014834 CTGTATCAGGATTAGGATGTAGG - Intronic
1088157762 11:106829515-106829537 CAGGATCAGGATGAATATGATGG + Intronic
1088810737 11:113390083-113390105 GAGGATCACGATGAGGAAGAGGG + Intronic
1088812921 11:113403577-113403599 CTGGATCAGCACTGGGAGGATGG + Intergenic
1089213116 11:116819722-116819744 CTGGAACATGCTAAGGAGGAGGG - Intergenic
1089643489 11:119863204-119863226 GAGAAGCAGGATGAGGAGGATGG + Intergenic
1089749996 11:120644607-120644629 ATGTCTCAGGAGGAGGAGGAAGG + Intronic
1090033582 11:123228922-123228944 CAGGGTCAGGATGAGAAGGCAGG - Intergenic
1090391774 11:126393460-126393482 ATGGCTCAGGAGGAGGGGGATGG + Intronic
1090402847 11:126460103-126460125 CGGGAGCAGGAGGAGGGGGAAGG + Intronic
1090922079 11:131215472-131215494 CTGGAACTGGCTGAGCAGGAGGG - Intergenic
1091635553 12:2194102-2194124 GAGGAGCAGGAGGAGGAGGACGG - Intronic
1091833561 12:3568249-3568271 ATGGAATAGGCTGAGGAGGAGGG + Intronic
1092132533 12:6122865-6122887 GGGGCACAGGATGAGGAGGAAGG - Intronic
1092843337 12:12562943-12562965 CGGGAGGAGGAGGAGGAGGAGGG - Intergenic
1093024231 12:14232222-14232244 CTGGCTCAGCCTGGGGAGGAGGG - Intergenic
1093922599 12:24876232-24876254 CTAGATCAAGAGGAAGAGGAGGG + Intronic
1096143890 12:49264861-49264883 CAGGAGCAGGAAGAGGAGGAAGG - Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096463602 12:51836364-51836386 TTGGATGAGGATGAGGATGGTGG - Intergenic
1096524221 12:52201034-52201056 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1096688848 12:53307160-53307182 CTGGGTCAGTATGAGATGGAAGG - Intronic
1096710505 12:53452221-53452243 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
1097221623 12:57454685-57454707 GTGGAGCATGATGTGGAGGAGGG - Intronic
1097797674 12:63880973-63880995 CCGGATCAGGAGTAGGGGGAGGG + Intronic
1097952262 12:65444932-65444954 CTGGATAAGGATATGTAGGAGGG - Intronic
1098241978 12:68477357-68477379 CTGGATCAGGACGATGATGGAGG - Intergenic
1098652422 12:72990106-72990128 CTAGAACAGGAGTAGGAGGAAGG - Intergenic
1099270003 12:80496977-80496999 CTGGATCTTAATGAGGAGGTTGG + Intronic
1099464441 12:82965772-82965794 CTGGATCAGAACAAGGGGGAGGG - Intronic
1101147772 12:101857443-101857465 CAAGAGCAGGAGGAGGAGGAAGG - Intergenic
1101660902 12:106764821-106764843 GCAGATCTGGATGAGGAGGATGG + Intronic
1101869996 12:108558304-108558326 TGGGATCAGGATGAGGTGGGTGG + Intronic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1102970484 12:117162231-117162253 ATGGATCATGATGAGGACGAAGG + Intronic
1102994877 12:117341372-117341394 CTAGGGCGGGATGAGGAGGACGG + Intronic
1103411673 12:120716630-120716652 CAGGAGGAGGATGAGGAGGAGGG + Exonic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1103844209 12:123890145-123890167 AGGGATCAGGACGAGGTGGAGGG + Intronic
1104429618 12:128705778-128705800 GTTGATCAGGAAGACGAGGATGG - Exonic
1104903015 12:132199217-132199239 CTGGACCAGGGAGCGGAGGACGG - Exonic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106649660 13:31676651-31676673 CTGAATCAGGATCAGGTGAAAGG - Intergenic
1107218916 13:37956210-37956232 TTAGATCAAGGTGAGGAGGAGGG + Intergenic
1107440741 13:40425387-40425409 CTGGAGCAGGGTGAGGTGGAGGG - Intergenic
1108004665 13:45934624-45934646 CAGTATCAGGAAGAGGAGGCTGG + Intergenic
1108596193 13:51951692-51951714 GGGGATGAGGAGGAGGAGGAGGG + Intronic
1110785948 13:79526174-79526196 TTGGATAAGGATGAGGGAGAAGG + Intronic
1111595320 13:90403814-90403836 CTGGAGGGGGATGAGGAGGCAGG - Intergenic
1111880584 13:93951386-93951408 CTGGCATAGGATGAGGAAGATGG - Intronic
1112116589 13:96362013-96362035 CTGCATCAGGATCACGGGGAGGG - Intronic
1113400908 13:109992565-109992587 CTGGAGCAGCCTGAGGAGGGGGG - Intergenic
1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG + Intergenic
1114317423 14:21521972-21521994 CTGGAGCAGGGGGAGGAAGAAGG + Exonic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115688505 14:35821277-35821299 AAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1116701399 14:48247870-48247892 CAGGATAAGGATGAGGATGAAGG - Intergenic
1117309668 14:54509418-54509440 GTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1118302218 14:64625943-64625965 CTGGATCTGGAGCAGGAGGGAGG + Intergenic
1118701229 14:68435175-68435197 CTAGATGGGGAAGAGGAGGATGG - Intronic
1119389045 14:74277749-74277771 CTGGAGCTGGAAGAGGAGAAAGG - Intergenic
1119539579 14:75429107-75429129 CTGGGTCAGTAGGAGGAGCAGGG + Intronic
1120059337 14:79963773-79963795 TTGGATTTGGAGGAGGAGGAGGG - Intergenic
1120899897 14:89566826-89566848 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1120999288 14:90440015-90440037 CTGGCTCAGGCTGAGGAGGGAGG - Intergenic
1121092161 14:91190433-91190455 ATGGACCAGGATGAGGAGACTGG + Intronic
1121254459 14:92521059-92521081 CTGGATGATGATTAGGAGGATGG - Intronic
1122540565 14:102495725-102495747 GTGGATCAGGACATGGAGGATGG - Intronic
1123125326 14:105941828-105941850 CTGGTGCAGGATGAGGAGGTGGG + Intergenic
1123787356 15:23686988-23687010 CTGCAGCAGGCTGCGGAGGAGGG - Exonic
1124449049 15:29768146-29768168 CTGGTTCAGGATCAGGATGAGGG + Intronic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1126230350 15:46316270-46316292 CTAGAACAAGAGGAGGAGGAGGG + Intergenic
1126492328 15:49251660-49251682 CTGGTGCAGGGTGAGGTGGATGG - Intronic
1128334174 15:66775535-66775557 CTGGATCAGGGCCAGGAGGCAGG + Intronic
1128617010 15:69118103-69118125 CTGAATCAGAATCTGGAGGAGGG + Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129011357 15:72420771-72420793 CTGAAGCAGAATGAGGAAGAGGG - Intergenic
1129599275 15:76988828-76988850 CAGAAACAGGATGAGGAAGAAGG - Intergenic
1129601755 15:77003192-77003214 CAGGCTCTGGGTGAGGAGGAAGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130298663 15:82664382-82664404 CAGGATGAGGATGAGGAGAAAGG - Exonic
1130441601 15:83960354-83960376 CTGGACCAGAATGAGGGGGAAGG + Intronic
1130843396 15:87722855-87722877 CTGAGACAGGGTGAGGAGGATGG + Intergenic
1130938530 15:88489600-88489622 CGGGATCAGGCGGAGGAAGAAGG - Intergenic
1131300429 15:91194967-91194989 CAGGATCAGAATGAAGATGAAGG + Intronic
1132014263 15:98301844-98301866 GAGGAGGAGGATGAGGAGGAGGG + Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1132549152 16:547232-547254 GAGGAGCAGGAGGAGGAGGAGGG + Exonic
1132577391 16:670308-670330 CTGGCTCATGATGGGGAGCACGG - Exonic
1132992538 16:2804317-2804339 CTGGAGCAGGGAGAGGAGAAAGG - Intergenic
1133367656 16:5223724-5223746 CAGGATTCTGATGAGGAGGAAGG + Intergenic
1133404767 16:5514720-5514742 GAGGAGCAGGAGGAGGAGGAGGG + Intergenic
1133534990 16:6693245-6693267 GTGGATGAGGATGATGATGATGG - Intronic
1133535025 16:6693495-6693517 GTGGATGAGGATGATGATGATGG - Intronic
1133535053 16:6693725-6693747 GTGGATGAGGATGAGGATGATGG - Intronic
1134174687 16:11996086-11996108 CTGGTTCAGGAGGTTGAGGATGG - Intronic
1134868225 16:17628147-17628169 CTGGGTGAGGAAAAGGAGGAAGG - Intergenic
1135073577 16:19373699-19373721 CTGGCTCAGAATATGGAGGAGGG + Intergenic
1135547988 16:23378558-23378580 TTGGATGAGGAGCAGGAGGAAGG - Intronic
1135664829 16:24326906-24326928 CTGGTTCAGGATCAGGTGGCAGG - Intronic
1136030778 16:27501306-27501328 ATGGATCAGGAGAAGCAGGAAGG - Exonic
1136142938 16:28298842-28298864 CCAGATCAGAAGGAGGAGGATGG - Intronic
1136841543 16:33545942-33545964 CAGGATCAGGGTCAGGAGCAGGG + Intergenic
1137267415 16:46880667-46880689 CTGGACCAGGGTGTGGGGGATGG - Intergenic
1137828736 16:51523870-51523892 CTGGATCAGGAGCAGGAAGATGG + Intergenic
1138244582 16:55457952-55457974 CTGGGTCAAGATGTGAAGGATGG + Intronic
1138279542 16:55762313-55762335 CTTCAACAGGATGAGGTGGATGG - Intergenic
1138288984 16:55831365-55831387 CTTCAACAGGATGAGGTGGATGG + Intronic
1139031174 16:62882704-62882726 CTGGAGCAGAAGGACGAGGAAGG + Intergenic
1139811733 16:69624605-69624627 GTGGATAGGGATAAGGAGGAAGG - Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1140194290 16:72844131-72844153 CTGGATCAGGGTGAGGTCCAAGG + Intronic
1140234227 16:73144181-73144203 CGGGATCAGGACAAGGATGAGGG + Intronic
1140301740 16:73764601-73764623 CTGGCTCAAGATGAGAAGGAAGG + Intergenic
1141749030 16:85946014-85946036 GTGCATAAGGATGGGGAGGATGG + Intergenic
1141775746 16:86121705-86121727 AGGGACAAGGATGAGGAGGAAGG - Intergenic
1142026725 16:87818405-87818427 CTCGGTCAGAAAGAGGAGGAGGG + Intergenic
1203151708 16_KI270728v1_random:1846239-1846261 CAGGATCAGGGTCAGGAGCAGGG + Intergenic
1142570713 17:872045-872067 CTAAAACAGGATGAGGAAGAAGG + Intronic
1142752472 17:1997327-1997349 CTGGAGCTGGCTGAGGACGATGG - Intronic
1142853477 17:2716782-2716804 CTGCATAAAGATAAGGAGGAGGG + Intergenic
1143391491 17:6561523-6561545 GAGGATGAGGAAGAGGAGGAGGG - Intergenic
1143622658 17:8089790-8089812 CTTGATCAGGGTTGGGAGGAGGG - Intergenic
1143849182 17:9796826-9796848 CTGGAATAGAGTGAGGAGGAAGG + Intronic
1144003888 17:11082060-11082082 CTGGTTCATGAGGAGGAGGGTGG - Intergenic
1144422347 17:15109916-15109938 CAGGATGAGGTTGAGGAGGTGGG - Intergenic
1144454868 17:15410435-15410457 CTTGATGAGGATGAGGAGTGAGG - Intergenic
1144717980 17:17447377-17447399 CTGGATCAGGATCACCAGGGTGG + Intergenic
1144832551 17:18139800-18139822 CAGGATCAGGATGAGGCGCTAGG - Intronic
1144942742 17:18952703-18952725 CTGGATCAGAATCCGGAGGCAGG + Intronic
1144967346 17:19086028-19086050 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1144980573 17:19166038-19166060 AAGGAGAAGGATGAGGAGGAGGG - Intergenic
1144987649 17:19212195-19212217 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1145212990 17:21028940-21028962 CAGGATCAGGAGCAGGAGGTGGG - Intronic
1145810069 17:27759220-27759242 CAGGCTCAGGATGAGGTGCATGG + Intronic
1145883085 17:28365644-28365666 GTGGGACAGGATGAGAAGGATGG + Intronic
1146300030 17:31680653-31680675 CAGGAGGAGGATGAGGTGGAAGG + Intergenic
1146418252 17:32657030-32657052 CTTGATTAGGATGAGAAGCATGG - Intronic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1147121792 17:38339398-38339420 CCAGGTAAGGATGAGGAGGATGG - Exonic
1148472835 17:47906182-47906204 GTGGATCATGGTGATGAGGATGG + Intronic
1148496985 17:48058919-48058941 CTGGATCTGGAAGAGGCCGAGGG + Exonic
1148799375 17:50213751-50213773 CTGGGTCAGGAGGAGGGGGCAGG - Intergenic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1149441415 17:56677787-56677809 ATTGATCAGGTTGAGGAGGAGGG - Intergenic
1149479634 17:56992319-56992341 CTGAGTCAGCATGAAGAGGAGGG + Intronic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1150964023 17:69947225-69947247 GAGGAGCAGGAGGAGGAGGAGGG - Intergenic
1151496624 17:74461940-74461962 ATGGATCAGGATGGGGTGGGAGG - Intergenic
1151536591 17:74742341-74742363 GTGGTTCAGGGTGAGAAGGAAGG - Intronic
1151874002 17:76856303-76856325 CTGGATCGGGAAGGGGAGGCAGG + Intergenic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152011541 17:77721874-77721896 CTGGCTCAGGAGGAGGGGAAGGG + Intergenic
1152059775 17:78063375-78063397 GAGGAGCAGGCTGAGGAGGAAGG + Intronic
1152091656 17:78250791-78250813 GTGGGTCAGGAAGAGGATGAGGG + Intergenic
1152100850 17:78301082-78301104 CAGGAACAGGATGAGGTGAAGGG - Intergenic
1152176692 17:78792572-78792594 CTGAATCAGAATGCGGGGGAAGG + Intronic
1152616308 17:81339529-81339551 CTTGATCAGGAAGGGGAGGCAGG - Intergenic
1152703665 17:81832376-81832398 TGGGATCAGGATGGGGAGGAGGG - Intronic
1153290152 18:3493034-3493056 CAGGAGCATGTTGAGGAGGAGGG + Intergenic
1154032520 18:10766224-10766246 GAGGAACAGGAGGAGGAGGAGGG + Intronic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1157106647 18:44780300-44780322 CAGGATCAGGAAGAGGAGTCAGG - Intronic
1157382031 18:47227207-47227229 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1157700234 18:49757676-49757698 GTGGCTCTGGATGAGCAGGACGG + Intergenic
1157808036 18:50672780-50672802 CTGGATCAAGGGGAGGAGCAAGG + Intronic
1157867107 18:51196977-51196999 CTGGAAGAGGACGAGGAGGAGGG - Exonic
1158423153 18:57313609-57313631 CAGGAGGAGGAAGAGGAGGAAGG + Intergenic
1158583951 18:58712829-58712851 CTTGATCAGGATGAGGGGTGCGG + Intronic
1158617984 18:59005433-59005455 CTGGGACAGAATGAGGAGGGAGG + Intergenic
1158626878 18:59079239-59079261 GTGGAGCAGGATGTGGAGAAGGG + Intergenic
1158803123 18:60936803-60936825 CTGGAGCAGGAGGAAGAGGCAGG + Intergenic
1159040535 18:63319906-63319928 CAGGACCAGGAGGAGGAGAAAGG - Exonic
1159720295 18:71881543-71881565 CTGGGGGAGGATGAGGAGGGAGG - Intergenic
1159833125 18:73303061-73303083 CAGGATGAGGAGGAGGATGAGGG - Intergenic
1159913662 18:74169646-74169668 CTGAATCACCATGAGGAGCAGGG + Intergenic
1160231357 18:77052037-77052059 CTGGAAGAGGATGAGGAGGCTGG + Intronic
1160237694 18:77099017-77099039 GTCGATAAAGATGAGGAGGAGGG - Intronic
1161066828 19:2242768-2242790 CTGCATCAGGAAGAGGATGTTGG + Intronic
1161509544 19:4662919-4662941 CTGGGGTAGGAGGAGGAGGAAGG - Intronic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1162151202 19:8646864-8646886 CTAGATCCGGGTCAGGAGGAAGG - Intergenic
1162215013 19:9126855-9126877 CAGGAACAGCATGAAGAGGATGG + Exonic
1162378531 19:10318722-10318744 CTGGAGGAGGAAGAGGAGGCGGG - Intronic
1162922585 19:13912376-13912398 CCGGATGAGGATGAGGAGGAGGG + Exonic
1162996284 19:14337807-14337829 CTGGGCCAGGGGGAGGAGGAGGG + Intergenic
1163612291 19:18307873-18307895 CTGGAGGAGGAGGAGGAGGTAGG + Intronic
1163769257 19:19180723-19180745 CAGGATCAGGCTGAGGAGGGCGG + Exonic
1164945295 19:32288254-32288276 GTGGATCAGGAGAAGGAAGAAGG - Intergenic
1165004767 19:32795838-32795860 CTGGAGCAGGAGCAGGAGCAGGG + Intronic
1165427298 19:35753236-35753258 CTGCCTGAGGATGAGGAGGTGGG + Exonic
1165846222 19:38819398-38819420 CGGGGTCAGGATGCGGGGGATGG - Intronic
1166085631 19:40472806-40472828 CTGGGGTGGGATGAGGAGGAGGG + Intronic
1166343085 19:42150342-42150364 ATGGATGAGGAGGAAGAGGAGGG + Intronic
1166373574 19:42315209-42315231 GAGGATGAAGATGAGGAGGAAGG - Exonic
1166567932 19:43776447-43776469 TCAGATCAGGAGGAGGAGGAGGG + Intronic
1166702117 19:44888236-44888258 CTGGATCTAGAGGATGAGGAGGG + Exonic
1167189961 19:47979169-47979191 ATGGAAGAGGAGGAGGAGGAGGG - Intronic
1167270476 19:48503035-48503057 TTGGGGCAGGATGAAGAGGAAGG - Intronic
1167299546 19:48670948-48670970 CTGGCCCAGGAGGAGCAGGAGGG + Exonic
1167556871 19:50202302-50202324 CTGGAGCAGTATGAAGGGGAGGG + Intronic
1167767651 19:51494957-51494979 CTGCAGGAGGATGAAGAGGATGG + Intronic
1167786715 19:51643599-51643621 CCTGATCAGGGTGAGGACGAGGG + Exonic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
925045529 2:770620-770642 GTTGAGCAGGCTGAGGAGGAGGG + Intergenic
925263352 2:2546985-2547007 CTGCCCGAGGATGAGGAGGATGG + Intergenic
926208272 2:10849404-10849426 CTGGAGCAGGAGGAAGAGGGTGG + Intronic
926240375 2:11080716-11080738 AGTGATCATGATGAGGAGGAGGG - Intergenic
926418151 2:12671144-12671166 CTGAATCAGGAGTGGGAGGATGG - Intergenic
926698184 2:15785078-15785100 GTGGGTCAGGATGAGGAGCAGGG + Intergenic
926988966 2:18656210-18656232 CTGGCTCTGTCTGAGGAGGATGG + Intergenic
927158840 2:20239774-20239796 CTGGATCAGGATCCAGGGGAGGG - Intergenic
928166633 2:28977055-28977077 CTGGCCCAGGCTGAGGAGAAAGG - Intronic
929073469 2:38057792-38057814 CTGGATCAGAAGGAAGAGGGAGG - Intronic
930362162 2:50394845-50394867 CTGGAGGAGCATGAGCAGGAAGG - Intronic
930774756 2:55160908-55160930 CTGATGCTGGATGAGGAGGAAGG - Intergenic
931168758 2:59779740-59779762 TTTCATCAGAATGAGGAGGAGGG + Intergenic
931295805 2:60923984-60924006 CTGGAGCTGCATGAGGAGGTGGG - Exonic
932201257 2:69830094-69830116 ACGGACGAGGATGAGGAGGAGGG + Exonic
932688261 2:73891721-73891743 CTGGATCAGGGTGAGGGAGGGGG + Intergenic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
933778891 2:85787924-85787946 CTGGGCCAGTATGTGGAGGATGG + Exonic
933849354 2:86353082-86353104 CTGGACCAGGATGAGGGCTAAGG - Intergenic
933861966 2:86478479-86478501 CTGGAGCAGGATGAAAAGGAGGG + Intronic
934535320 2:95128581-95128603 GAGGATGAGGAGGAGGAGGAGGG + Intronic
934800568 2:97153493-97153515 CTTGATCAGGATGTTGAGCAAGG - Intronic
934994374 2:98943624-98943646 CTAGATCATGATGTGGATGATGG - Intergenic
935531665 2:104240362-104240384 AGGGAGGAGGATGAGGAGGAGGG + Intergenic
935971517 2:108534440-108534462 CCGGAGCAGGAAGGGGAGGAAGG - Intronic
937031862 2:118747518-118747540 CTGGAAGAGGAAGAGGTGGAGGG - Intergenic
937845367 2:126573448-126573470 ATGGTTCAAGGTGAGGAGGAAGG - Intergenic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
938928617 2:136066635-136066657 ATGGATGAGGGTGAGGTGGATGG + Intergenic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
939432677 2:142130901-142130923 CTGGAGCAGGATGTGGAAGGTGG + Exonic
940340593 2:152576858-152576880 CTGGATCAGAATGAGTAAGAGGG + Intronic
940719349 2:157264739-157264761 CTGGAGGAGGAAGAGGAGGAGGG + Intronic
941515522 2:166471130-166471152 GAGGATGAGGATGAGGATGATGG + Intronic
941640180 2:167978760-167978782 GCGGATCAGGAAGAGGAAGATGG - Intronic
942306393 2:174611499-174611521 TGGTATCAGGAGGAGGAGGAGGG + Intronic
942321681 2:174741715-174741737 CTGGATGGGGAAGAGGAGGCAGG - Intergenic
943454619 2:188089554-188089576 AGGGATCAGGATTAGGAAGAGGG + Intergenic
944200476 2:197101972-197101994 GTGTATGAGGATGAAGAGGAAGG - Intronic
944263939 2:197704316-197704338 CTGGTTCAGTATGTGGGGGATGG + Intronic
944315244 2:198277733-198277755 CAGGATCTGGAGCAGGAGGAGGG - Intronic
945986021 2:216354243-216354265 CAGGATTAGGCTGAGTAGGAAGG + Intronic
946429787 2:219619172-219619194 GAAGATGAGGATGAGGAGGAAGG + Intergenic
946433717 2:219638821-219638843 CAGGATGAGGACGAGGAGGGCGG - Exonic
946458067 2:219845259-219845281 TTGAGGCAGGATGAGGAGGAGGG + Intergenic
946463370 2:219889918-219889940 CTGGGGCAAGATGAGGAAGAGGG - Intergenic
946844574 2:223848012-223848034 CTCAGTCAGGATGAGGATGATGG + Intergenic
947718390 2:232352939-232352961 CTGGATCAGGAGCTGGGGGAAGG - Intergenic
947728831 2:232417149-232417171 CTGGTTTAGGGTGGGGAGGATGG - Intergenic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948428310 2:237902285-237902307 AGGGATCGGGAGGAGGAGGAGGG + Intronic
948428345 2:237902380-237902402 AGGGATCAGGAGGAAGAGGAGGG + Intronic
948829578 2:240591782-240591804 CTTGGTGAGGATGAGGAAGAAGG + Intronic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1169261535 20:4142320-4142342 CTGAATCACTATGTGGAGGAAGG + Intronic
1169325253 20:4670551-4670573 CAGGATGAGGAGGAGGAAGAGGG + Intergenic
1169474892 20:5922631-5922653 GAGGATGAGGAGGAGGAGGAGGG + Exonic
1169692023 20:8342841-8342863 CTGGAAGAGGATGAGTAGAAAGG + Intronic
1169877084 20:10309800-10309822 CTGGAGGAGGATGTGGAAGAAGG - Intergenic
1170146660 20:13182531-13182553 CTGGATCATGAGGAGGTTGAGGG - Intergenic
1170396037 20:15926553-15926575 GTTGATCAGGATAAGAAGGATGG + Intronic
1170733213 20:18991583-18991605 CTGGACCAGGATGGGGACTATGG - Intergenic
1170809721 20:19664484-19664506 CAAAATGAGGATGAGGAGGAAGG - Intronic
1171087434 20:22250622-22250644 CTGGAGCAGGAGGAGGGAGAGGG + Intergenic
1172689003 20:36777798-36777820 AGGGGCCAGGATGAGGAGGAAGG + Exonic
1172776312 20:37409257-37409279 CTGGACCAGGATGGGGAGTGAGG - Intergenic
1173125073 20:40328965-40328987 CTGAATCAGAATGGGGAGGAAGG + Intergenic
1173630434 20:44509979-44510001 CTGAATGAGGATGAAGAGGGCGG + Exonic
1173750091 20:45469816-45469838 CAGCAGCAGGCTGAGGAGGAGGG - Exonic
1173856850 20:46255724-46255746 CTGGAGCAGGAAAAGGAAGAAGG - Intronic
1174094961 20:48081010-48081032 CAGGCTGAGGATGAGGAGAAGGG + Intergenic
1174274717 20:49395490-49395512 CTGGATCAGGAATATGCGGATGG + Intronic
1174548357 20:51343422-51343444 CTGGAGCAGGGTGAGGAGGAAGG + Intergenic
1174736813 20:52972747-52972769 GTGGAGGAGGAGGAGGAGGAGGG + Exonic
1175855108 20:62116921-62116943 CAGGAGCTGGATGGGGAGGATGG - Intergenic
1175942949 20:62546293-62546315 CGGGTGCAGGAGGAGGAGGATGG + Intergenic
1178301114 21:31453883-31453905 CTGGACCAGGCTGAGCAAGAAGG - Intronic
1178470817 21:32891138-32891160 TGGGATCAGGAAGAGGAGGGAGG + Intergenic
1178493707 21:33070370-33070392 GTGGAGGAGGAGGAGGAGGAGGG - Exonic
1178887179 21:36493598-36493620 CTGGGGCACGAGGAGGAGGAGGG + Intronic
1178964745 21:37105647-37105669 ATGGATCATGACTAGGAGGAGGG - Intronic
1179554498 21:42163590-42163612 CTGGATGAGGGGGAGGAGGAGGG + Intergenic
1179664763 21:42903463-42903485 CTGGAAGAGGATGAAGACGAAGG - Exonic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180726624 22:17951246-17951268 CTGGATTAGGATCAGGAGACAGG + Intronic
1180754063 22:18148051-18148073 CTGGAGCAGGTTGAGGAGGGTGG - Intergenic
1180974360 22:19839120-19839142 ATGGATCAGAAGGAGGGGGAGGG + Intronic
1181418249 22:22775779-22775801 CTGGATGTCAATGAGGAGGAAGG - Intronic
1181683744 22:24514479-24514501 CAGGATCAGGAGGAGGTGGAAGG + Intronic
1181886087 22:26023514-26023536 CAGGAGGAGGAAGAGGAGGAGGG - Intronic
1181886238 22:26024438-26024460 CTGGAGCAGCATGAGCAAGAGGG + Intronic
1182597595 22:31434064-31434086 CTGGATCAGGATCCAGGGGAGGG + Exonic
1182910734 22:33982068-33982090 ATGGAACAGGAAGAGGAGGGCGG + Intergenic
1183072901 22:35408649-35408671 CTGGAGCAGGGTGAGTAGGGTGG + Intronic
1183328432 22:37206731-37206753 GAGGATGAGGAGGAGGAGGATGG - Exonic
1183342094 22:37287069-37287091 CAGGAAGAGGATGGGGAGGAGGG + Intronic
1183372006 22:37438109-37438131 CTGGTTCAGGCTGGGGAGGTCGG - Intergenic
1183598204 22:38824873-38824895 CTGGAGGGGGAGGAGGAGGAGGG - Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183991283 22:41598619-41598641 CTGGATCTGGAAGAGGAGAAAGG + Exonic
1184859720 22:47166256-47166278 CTGGAGCAGGCAGAGGAGGGAGG + Intronic
949515442 3:4803117-4803139 CTGGAACAGGAGGAAGCGGATGG + Intronic
949644994 3:6083332-6083354 CTAGAACAGGCAGAGGAGGAGGG - Intergenic
950151305 3:10689660-10689682 CCTCAGCAGGATGAGGAGGATGG - Intronic
950481601 3:13247727-13247749 CTGGATCTGGATCTGGAGGGAGG + Intergenic
950566186 3:13771038-13771060 CTGGAGCAGAGTGAGCAGGAGGG - Intergenic
950897553 3:16467378-16467400 CTGGAGCAGTCTGAGAAGGAGGG - Intronic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
951735386 3:25857906-25857928 CTAGATCTGGATAAGGGGGAGGG - Intergenic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
953230250 3:41058328-41058350 GTGGAGGAGGAGGAGGAGGAGGG + Intergenic
954121844 3:48504229-48504251 GGGGAGCAGGAGGAGGAGGAGGG + Exonic
954188588 3:48939887-48939909 CTGGAACAAGATGAAGATGATGG - Intronic
954283834 3:49603552-49603574 ATGGGTCAGGAAGAGGATGAAGG + Intronic
954594743 3:51814708-51814730 CTGCTTTAGGAGGAGGAGGAGGG - Intergenic
954619297 3:51986495-51986517 CTGGATGAGGGTGAGCAGGTTGG + Exonic
955000001 3:54918779-54918801 CTGGATCAGGAGCAGGAAGAGGG + Exonic
957361436 3:79164497-79164519 CTGGATCAAGATGAGAGTGATGG - Intronic
959892351 3:111570756-111570778 CTGGATCTAGAGGATGAGGAGGG - Intronic
960066155 3:113375221-113375243 GTGTTACAGGATGAGGAGGACGG + Intronic
961345369 3:126260398-126260420 TTGGATTAGGGTTAGGAGGAGGG - Intergenic
961345384 3:126260457-126260479 TTGGATTAGGGTTAGGAGGAGGG - Intergenic
961508015 3:127384223-127384245 CTGGAGCAGGAGGAGGAGGTGGG + Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963300889 3:143596003-143596025 CTGGACCAGGATGAGATGGAGGG + Intronic
963456754 3:145555219-145555241 GAGGATCAGGCTGGGGAGGAGGG + Intergenic
964452676 3:156826639-156826661 CCGGAAGAGGAGGAGGAGGAGGG - Exonic
964472670 3:157071146-157071168 CAGGATCAGCTTGAGGAAGAGGG - Intergenic
966470488 3:180283402-180283424 CAGGATCAGGGCAAGGAGGAGGG + Intergenic
966476824 3:180358375-180358397 CTGAGTCAAGATGAGGAGGCAGG - Intergenic
967227068 3:187302210-187302232 CTGGATAAGAATGAAGAAGAGGG - Intergenic
967983375 3:195078535-195078557 TTGGATGGGGATGAGGAAGAGGG - Intronic
968293294 3:197555247-197555269 CCGGAGGAGGAGGAGGAGGAGGG + Intronic
968527764 4:1072459-1072481 CTGGTGGAGGATGAGGATGATGG + Intronic
968695655 4:2024930-2024952 CTGGATCAGGGTGATTGGGAGGG + Intronic
969670163 4:8585792-8585814 CGGGATGGGGATGAGGAGGCTGG - Intronic
970113926 4:12671431-12671453 TTGGCTGAGGAGGAGGAGGAGGG + Intergenic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
971267636 4:25109102-25109124 CTGGCTCAGTCTCAGGAGGAGGG - Intergenic
971353561 4:25873930-25873952 CTGGGTCAGGTTTAGCAGGATGG + Intronic
971956678 4:33429607-33429629 CTGGTTTAGGGTGAGGAGAAGGG + Intergenic
972232796 4:37094944-37094966 CTGAATCATGATGAGGTGGCAGG + Intergenic
972290563 4:37686529-37686551 CGGGATCAGGCTGAGGTGGGCGG - Intergenic
972539820 4:40029620-40029642 CAGGACCAGGATTAGGATGAAGG - Intergenic
973156484 4:46961335-46961357 CGGGAGGAGGATGAGGAGGATGG - Intronic
973330313 4:48905964-48905986 TAGGATGAGGATGAGGATGAGGG + Intronic
973966670 4:56170088-56170110 ATGGAGGAGGAAGAGGAGGAAGG - Intergenic
974310399 4:60200902-60200924 CTGAATCAGAATGAAGTGGAGGG - Intergenic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
974828674 4:67162204-67162226 CTAGATGAGGTTGAAGAGGAGGG - Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976205315 4:82618583-82618605 CTGGATGTGGGTGATGAGGAAGG + Intergenic
976335138 4:83876922-83876944 CTGGATTAGGCAGAGGAAGAAGG + Intergenic
976604604 4:86970886-86970908 CTGGAGCAGAATGTTGAGGAGGG + Intronic
976801455 4:88996392-88996414 CTGGATCAGGCTGATGCTGACGG + Intronic
978008530 4:103650214-103650236 CTGGAGCTGGGTGAGGTGGATGG + Intronic
979990326 4:127367520-127367542 CTGTATCAGGTAGAGGAGAAAGG + Intergenic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982463738 4:155704495-155704517 CTGCATCAGGAGGAGGTAGAAGG + Intronic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
983608846 4:169620382-169620404 CTGGGTCTCGAGGAGGAGGAGGG - Intronic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
983919821 4:173333856-173333878 CGGGAGGAGGAGGAGGAGGAGGG - Intronic
984102488 4:175502168-175502190 CTTGATGAGGTTGAGGAGAATGG + Intergenic
985294823 4:188425503-188425525 CAAGAGCAGGATGGGGAGGAAGG - Intergenic
985498399 5:224599-224621 CTGGAGCAGGGGGAGGAGGCAGG - Intronic
985992732 5:3576697-3576719 TTGGGTCAGGATAAGCAGGAGGG + Intergenic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987851289 5:23358754-23358776 AAGGAAGAGGATGAGGAGGAGGG - Intergenic
987961470 5:24814585-24814607 CTGAATTTGGATGAGGAAGAGGG + Intergenic
988006492 5:25418476-25418498 CTGGAGCAGGAGGAAGGGGAGGG + Intergenic
988856500 5:35232662-35232684 CTGCATCAGGCTGAGAAGCAAGG - Intergenic
990327492 5:54692584-54692606 CTGGCCTAGGATGTGGAGGATGG + Intergenic
990601826 5:57366770-57366792 CTTGAGCAGGAAGAGGAGGAAGG + Intergenic
990708654 5:58558374-58558396 CTTGATCAGAAGAAGGAGGAAGG - Intergenic
991955466 5:71989761-71989783 CTAGATCAGGCTGAAGAGGTAGG - Intergenic
991974936 5:72176341-72176363 GTGGATCAGGAAAAGGAGAAAGG + Intronic
992201011 5:74383977-74383999 GTGGATGAGGAGGAGAAGGAGGG + Intergenic
992349716 5:75916396-75916418 GTGGAGGAGGAGGAGGAGGAAGG - Intergenic
992804137 5:80320269-80320291 CTTGATGAGGATCAGGAGTAGGG - Exonic
993505106 5:88699712-88699734 CAGGAAGAGGATGAGGAGAAAGG - Intergenic
994640384 5:102401266-102401288 CTGGATCAGAATGAACATGAAGG + Intronic
995030736 5:107478169-107478191 CTGGATCAGGAGGAGAAGCAGGG - Intronic
996344169 5:122471798-122471820 AAGGATGAGGGTGAGGAGGAGGG - Intergenic
996886010 5:128354316-128354338 CTGGCTCAGGCTGAGGGGGTGGG + Intronic
996911010 5:128656571-128656593 CTGGAGCAGGAGGAAGAGCAAGG + Intronic
997355557 5:133260616-133260638 CTGGACCAGGAGGTGGAGGGCGG - Intronic
997356944 5:133268608-133268630 CTGTCTCAGGATGAGCAGGAAGG - Intronic
997512963 5:134465923-134465945 TCGGAGCAGGACGAGGAGGAGGG - Intergenic
997658788 5:135574691-135574713 ACGGAGCAGGATGAGGTGGAGGG + Intronic
998011596 5:138699708-138699730 CTGGAGCTGGATGAGCAGGAGGG + Intronic
998090470 5:139364137-139364159 CTGAATCAGGAGGATGAGGGTGG + Intronic
998157653 5:139795760-139795782 CTGGAGGAGGAGGAGGAGGGAGG - Intergenic
998193099 5:140043288-140043310 CTGGAGGAGGATGCGGAGGATGG + Exonic
999267272 5:150275076-150275098 GTGCAGAAGGATGAGGAGGAAGG + Intronic
999318841 5:150601055-150601077 CTGGAGCAGGCTGAGCGGGATGG - Intergenic
999432636 5:151537276-151537298 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
1000304467 5:159983114-159983136 CTGGGTCAGGTTGAAGGGGAAGG - Intergenic
1001825203 5:174739289-174739311 CAGGATCAGGAACAGCAGGATGG + Intergenic
1002101745 5:176861330-176861352 CAGGTTCAGGATGGGGTGGATGG + Intronic
1002189304 5:177470457-177470479 CTGGAGCAGGAAGAGGTGGCCGG - Intronic
1002196433 5:177504083-177504105 CTGGAGCTGGATCAGGTGGAGGG - Exonic
1002715486 5:181224180-181224202 CGGGAGGAGGAGGAGGAGGACGG + Exonic
1003105395 6:3211326-3211348 AGGGAGCAGGAGGAGGAGGATGG - Intergenic
1004019177 6:11761016-11761038 CTGGTTCAGATTGAGGAGGGAGG - Intronic
1004643654 6:17539334-17539356 CTGGAGGAGGCAGAGGAGGAGGG - Exonic
1005284148 6:24306440-24306462 CTGGAGCAGGCTGAAGAGGCTGG + Intronic
1005495450 6:26383862-26383884 GAGGAGCAGGAGGAGGAGGAGGG - Exonic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1005654429 6:27919534-27919556 CAGTATCAGGAGGAGAAGGAGGG + Intergenic
1006066433 6:31465630-31465652 ATGGATGAGTAAGAGGAGGAAGG - Intergenic
1006094072 6:31644897-31644919 CAGGATCAGCATGATGAGGGAGG - Intronic
1006457539 6:34140591-34140613 CTGGCTCTGGGAGAGGAGGAAGG - Intronic
1006810947 6:36820165-36820187 CTGGGTCAGGATGAGGGGTCCGG - Intronic
1007118628 6:39362297-39362319 CTAGAACAGCAGGAGGAGGAGGG - Intronic
1008137249 6:47791011-47791033 TTGGAGGAGGATGAGGTGGAAGG + Intronic
1008400450 6:51056719-51056741 CTGCTTCAGGATGAGGAACATGG - Intergenic
1009400394 6:63247901-63247923 CAGGATGAGGAAGAGCAGGAAGG + Intergenic
1010032752 6:71288366-71288388 CTGGACCAGGGAGAGGGGGAGGG + Intergenic
1010098217 6:72072115-72072137 CTGGGTCAGGATGATGTTGAAGG + Intronic
1010163607 6:72889288-72889310 CTGGAACAGAATGAGGCAGAGGG + Intronic
1010946648 6:81982080-81982102 CTGGATCATGTTCAGGGGGAAGG - Intergenic
1011069997 6:83370565-83370587 CTCAAGCAGGATGAGTAGGATGG - Intronic
1012550999 6:100464754-100464776 CTGGATCATGAATTGGAGGAGGG + Exonic
1014303373 6:119711264-119711286 CTGGCACAAGCTGAGGAGGAGGG - Intergenic
1014434219 6:121403486-121403508 CTGGATCAGTATTAGGGTGATGG - Intergenic
1014528074 6:122524219-122524241 GAGGATGAGGAAGAGGAGGAGGG - Intronic
1015121368 6:129704897-129704919 AGGGGTCAGGATAAGGAGGAGGG - Intronic
1015557295 6:134476402-134476424 CTGCATCAGAATAATGAGGAAGG - Intergenic
1016828921 6:148414346-148414368 ATGGTTCAGGATGAGGGCGAGGG + Intronic
1016985356 6:149890772-149890794 CTGGCTGAGGACAAGGAGGAGGG - Intronic
1017060980 6:150484742-150484764 ATGGACCAGGATGTGGGGGATGG + Intergenic
1017969518 6:159299548-159299570 CTGGGTGAAGAAGAGGAGGAAGG + Intergenic
1017989316 6:159472396-159472418 CTGGATCAGGAGGAAGAGAGAGG + Intergenic
1018220205 6:161570501-161570523 GTGGCTGAGGAGGAGGAGGAGGG - Intronic
1018329156 6:162709260-162709282 ATGGATCAGGGCGAGGAGGGTGG - Intronic
1018437595 6:163776875-163776897 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1018577705 6:165276753-165276775 TTCCATGAGGATGAGGAGGAAGG - Intergenic
1018924285 6:168195531-168195553 ATGGAGCAGGGGGAGGAGGAGGG - Intergenic
1018996730 6:168715904-168715926 GAGGATGAGGAGGAGGAGGATGG + Intergenic
1019324060 7:429419-429441 CTGGATCACGGAGAGGAGGCAGG + Intergenic
1019398127 7:834373-834395 CTGGATCAGGACCAGAGGGAAGG + Intronic
1019534270 7:1520375-1520397 CTGGAACAGAAGGTGGAGGAAGG + Intergenic
1019728513 7:2616811-2616833 CTGGATGGGGAAGAGGAAGAGGG - Intergenic
1019783470 7:2958656-2958678 TTGGAGCAGGAGGCGGAGGATGG + Intronic
1019816364 7:3204039-3204061 CTGGAGCAGGAGGAGGAGAGAGG + Intergenic
1020122602 7:5513518-5513540 CAGGGTCAGGATGGGAAGGACGG + Intronic
1020138528 7:5599513-5599535 ATGGAACAGGATGGGGAGGCCGG + Intronic
1020288653 7:6706184-6706206 CTGGAGCAGAGAGAGGAGGAAGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022873493 7:34503998-34504020 CTGGAGCAGGAGCAAGAGGAGGG + Intergenic
1023271706 7:38470114-38470136 GGGGATCAGGACAAGGAGGAAGG - Intronic
1023483321 7:40658482-40658504 CTTGATGAGGATGAGGAGAAGGG - Intronic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1026018916 7:66693424-66693446 CTGGCTCAGGGTGAGAAGGTAGG + Intronic
1026881480 7:73909252-73909274 CTGGCTCAGGGTGAGAAGGTAGG - Intergenic
1028888132 7:95957441-95957463 CAGCAGCAGGAGGAGGAGGAGGG - Intronic
1029450832 7:100641140-100641162 CTGGAGGAGGAAGAGGAAGACGG - Exonic
1029547088 7:101216327-101216349 CTGGGTGAGGAAGGGGAGGATGG + Intronic
1029695129 7:102207806-102207828 CTGGACCAGGAAGACTAGGAGGG + Intronic
1030539546 7:110812622-110812644 CTGGATCAGGATTGGGAGTTTGG + Intronic
1032441228 7:131944603-131944625 CTGGAGCAGGATGGGGGTGAGGG - Intergenic
1033158219 7:138974287-138974309 CTGGATCTCGGTGAGGTGGAGGG + Intronic
1033706842 7:143897281-143897303 TAGGCTAAGGATGAGGAGGAAGG - Intronic
1034255925 7:149724671-149724693 CAAGATCAGGATGGGGAGGAGGG - Exonic
1034434537 7:151057067-151057089 CTGGATGACGATGATGAGGTAGG - Exonic
1034446492 7:151116511-151116533 CTGGAGCAGGAAGAGGAGGAAGG + Intronic
1034760144 7:153664732-153664754 CTGAATCACGATGAGAAAGAAGG + Intergenic
1035693764 8:1577836-1577858 CAGGGGCAGGTTGAGGAGGAAGG - Intronic
1035722057 8:1799318-1799340 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1035827634 8:2661401-2661423 CTGGATTAGGAGGAGGACTAAGG + Intergenic
1036295217 8:7529242-7529264 CTGGAGAAGGAGGAGGAGAAGGG - Intergenic
1036327353 8:7791776-7791798 CTGGAGAAGGAGGAGGAGAAGGG + Intergenic
1037071102 8:14650223-14650245 ATGGATCAGGAGTAGGAGAAAGG + Intronic
1037991186 8:23322250-23322272 CTGGATCTCGTTGAGGTGGATGG + Exonic
1038577283 8:28716219-28716241 CTGGATGAGGCTGATGAGGCAGG + Exonic
1038964083 8:32551843-32551865 CTGAATCAGTATGAAGAGGCTGG - Intronic
1039347047 8:36716668-36716690 GTGATTCAGGAGGAGGAGGAAGG - Intergenic
1039503948 8:38038092-38038114 CTGTATGAGGATAAGTAGGAGGG - Intronic
1039599036 8:38818290-38818312 CTGGATTAGGATTAGGAAGTAGG + Intronic
1039769509 8:40669514-40669536 GTGGAGTAGGATGAAGAGGAGGG - Intronic
1039863421 8:41479356-41479378 CTGGACCAGGCAGAGGAAGAAGG - Intergenic
1040447654 8:47511873-47511895 GAGGATGAGGAAGAGGAGGAAGG - Intronic
1040552703 8:48450748-48450770 CTGTGTCTGGATGAGGGGGAAGG + Intergenic
1041324395 8:56649637-56649659 CTAAATCAGTATGAGGGGGATGG - Intergenic
1042027344 8:64438226-64438248 GTAGATCGGGATGATGAGGAAGG + Intergenic
1042312075 8:67388795-67388817 CAGGAGCAGGAGGAGGAGGGAGG - Intergenic
1042987958 8:74604454-74604476 GTGGAGGAGGAGGAGGAGGAAGG + Intronic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1044613283 8:94115287-94115309 CTACATTAGGAAGAGGAGGAGGG - Intergenic
1044653084 8:94519261-94519283 TATGATCAAGATGAGGAGGAAGG - Exonic
1044727582 8:95205760-95205782 CTGTATAAGGATAGGGAGGATGG + Intergenic
1045224902 8:100234925-100234947 GGGGCCCAGGATGAGGAGGAAGG + Intronic
1046053716 8:109054831-109054853 AAGGAGCAGGAGGAGGAGGAAGG - Intergenic
1046096836 8:109572664-109572686 CTGGAGCAGAGTGAGAAGGAAGG - Intergenic
1046906110 8:119574645-119574667 CTGAATCAGGAAGCTGAGGAGGG - Intronic
1047298665 8:123593688-123593710 CTGGAGCAGGATGATGAGTGGGG + Intergenic
1048462895 8:134637469-134637491 CTGAATTTGGGTGAGGAGGAAGG - Exonic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1049820191 8:144628795-144628817 CTGGACCAGGATGTGGGGCATGG - Intergenic
1049820366 8:144629757-144629779 CTGCGACAGGAAGAGGAGGAGGG + Intergenic
1049889428 9:54837-54859 CTGGAACAGAAGGAGGAGGGCGG - Intergenic
1051297402 9:15611120-15611142 CCAGATCAGGAGCAGGAGGAAGG - Intronic
1051666978 9:19474823-19474845 ATTGATAAGGAGGAGGAGGAGGG - Intergenic
1052975182 9:34405001-34405023 CTGGAGCCTGAGGAGGAGGATGG + Intronic
1053216198 9:36272658-36272680 ATGGATTGGGAAGAGGAGGAAGG + Intronic
1053599427 9:39595251-39595273 CTGGAGCAGGGTGAACAGGAGGG + Intergenic
1053857132 9:42349436-42349458 CTGGAGCAGGGTGAACAGGAGGG + Intergenic
1054254098 9:62747136-62747158 CTGGAGCAGGGTGAACAGGAGGG - Intergenic
1054302958 9:63391084-63391106 CAGGATCAGGGTCAGGAGCAGGG - Intergenic
1054568161 9:66781298-66781320 CTGGAGCAGGGTGAACAGGAGGG - Intergenic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1056238540 9:84620254-84620276 GTGGATGAAGATGATGAGGATGG + Intergenic
1056655576 9:88505989-88506011 CTAGGTCAGCAAGAGGAGGAGGG - Intergenic
1057339684 9:94188825-94188847 CTGGATCAAGGTGTGGTGGATGG - Intergenic
1057647440 9:96890071-96890093 CTGCCTCGGGATGTGGAGGATGG - Intergenic
1057801708 9:98195128-98195150 CTGGACCAGGATTAGAGGGAGGG - Intergenic
1058679760 9:107430686-107430708 CTGGATCAAGAGGAGGAGAAAGG + Intergenic
1058897917 9:109416032-109416054 CTAGATCTGAATGTGGAGGAAGG - Intronic
1059712408 9:116881125-116881147 GTGGAAGAGGAGGAGGAGGAAGG + Intronic
1060216236 9:121740128-121740150 CTGGCCCAGGATGTTGAGGAGGG + Intronic
1060277164 9:122191049-122191071 CTGGACCAGGACCTGGAGGAAGG - Intronic
1060552830 9:124493685-124493707 CAGGCTCAGGAGGAGGAGGGAGG + Intronic
1060934455 9:127507191-127507213 GTGGTCCAGGATGAGGAGGTGGG - Exonic
1060962886 9:127693608-127693630 CAGGATCAGAATGAGAATGATGG - Intronic
1061238867 9:129357799-129357821 CTGGTCCAGGCTGGGGAGGAGGG - Intergenic
1061847826 9:133397835-133397857 CAGGTTCAGGATGAGAGGGAGGG - Intronic
1062201857 9:135307156-135307178 CTGGGGGAGGAAGAGGAGGAAGG - Intergenic
1062499698 9:136847064-136847086 CTGGATCAGGACGGCGAGGCGGG + Exonic
1062626728 9:137446458-137446480 CTGTAACAGGCTGAGGAGGCAGG + Intergenic
1185521777 X:745657-745679 CTGGATGAGGATGAGGAGGGTGG - Intergenic
1185550763 X:981100-981122 ATGGAGGAGGACGAGGAGGAGGG + Intergenic
1185814997 X:3146430-3146452 AAGGATGAGGAAGAGGAGGAGGG - Intergenic
1186341966 X:8655059-8655081 CTGGGTGAGGAGGAGGAGAATGG + Intronic
1186633595 X:11377963-11377985 CTGGGCCAGGATGGGGAAGAAGG + Intronic
1187088400 X:16066572-16066594 CTGACACAGGATAAGGAGGAAGG - Intergenic
1187391721 X:18890640-18890662 GTGGGGGAGGATGAGGAGGAGGG - Intergenic
1187956690 X:24525520-24525542 TTGGGTCATGAGGAGGAGGAAGG + Intronic
1188065645 X:25656329-25656351 CTGGGTTAGGAGGTGGAGGAGGG - Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188390275 X:29611157-29611179 CTGGATCAGGAAGGAAAGGAAGG - Intronic
1188473905 X:30569630-30569652 CTGGAACAGTACAAGGAGGAAGG + Intronic
1189207503 X:39254437-39254459 CTAGAAAAGGAGGAGGAGGATGG + Intergenic
1189256321 X:39642504-39642526 CAGGATGAGGAGGAGGAGTAGGG + Intergenic
1189559938 X:42182063-42182085 CAGGGTCAGCGTGAGGAGGAGGG + Intergenic
1190329396 X:49226436-49226458 GGCGATGAGGATGAGGAGGAGGG - Exonic
1190497179 X:51037847-51037869 TAGGAAAAGGATGAGGAGGAGGG + Intergenic
1190750433 X:53357342-53357364 GAGGATCATTATGAGGAGGAGGG + Intergenic
1190801635 X:53794797-53794819 GAGGATCATTATGAGGAGGAGGG + Intergenic
1191256295 X:58281051-58281073 CTAGAGGAGGTTGAGGAGGATGG - Intergenic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192350799 X:70354857-70354879 TGGGGCCAGGATGAGGAGGAAGG + Intronic
1193396995 X:80996793-80996815 CTGGATGAGGATGTGGAGAAAGG + Intergenic
1193579624 X:83248426-83248448 CTGGAACAGAGTGAGGAAGAAGG - Intergenic
1194017236 X:88638202-88638224 CTGGGTCAGGATGTGGAGAAAGG + Intergenic
1194041647 X:88948823-88948845 CATGATGATGATGAGGAGGATGG - Intergenic
1195741424 X:108068555-108068577 CTGGAACAGGAGGAAGGGGAGGG + Intronic
1195935998 X:110126271-110126293 CTGGATCAGGAGGAGAGGGGTGG - Intronic
1196900033 X:120373895-120373917 GTGGAGCAGGAGGAGGAGGCGGG - Intronic
1196940339 X:120769578-120769600 CAGGATCAGAATTAGGGGGAGGG + Intergenic
1197588033 X:128373805-128373827 CTGGAGTAAGCTGAGGAGGAAGG - Intergenic
1197588096 X:128374330-128374352 CTGGAGCAAGATGGGGAAGAAGG - Intergenic
1198658219 X:138937926-138937948 CTGGAGCAGGATGTAGATGAAGG + Intronic
1199117251 X:144007724-144007746 CTGGAACAGGAGGAAGAGAAAGG + Intergenic
1200152540 X:153958350-153958372 TGGGAGCAGGAGGAGGAGGAAGG - Intronic
1200363023 X:155631090-155631112 CTGGAGCAGGGAGAGAAGGAGGG - Intronic
1201073155 Y:10168535-10168557 CTGGCTGAGGGTGGGGAGGAGGG + Intergenic
1201190395 Y:11438827-11438849 CAGGACCAGGGTCAGGAGGAGGG - Intergenic
1201311103 Y:12598690-12598712 CTGGTTCAGGAAGGGGAGGGTGG + Intergenic
1201739734 Y:17311109-17311131 CAGCAGCAGGAGGAGGAGGAGGG - Intergenic