ID: 1072252753

View in Genome Browser
Species Human (GRCh38)
Location 10:93594581-93594603
Sequence ATTAATAAGCAGAATTAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 588
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 546}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072252753_1072252756 10 Left 1072252753 10:93594581-93594603 CCATCCTAATTCTGCTTATTAAT 0: 1
1: 0
2: 1
3: 40
4: 546
Right 1072252756 10:93594614-93594636 TCTTTGTGCCGGCAAAGAGTAGG No data
1072252753_1072252755 -1 Left 1072252753 10:93594581-93594603 CCATCCTAATTCTGCTTATTAAT 0: 1
1: 0
2: 1
3: 40
4: 546
Right 1072252755 10:93594603-93594625 TGCTACTCACTTCTTTGTGCCGG No data
1072252753_1072252758 23 Left 1072252753 10:93594581-93594603 CCATCCTAATTCTGCTTATTAAT 0: 1
1: 0
2: 1
3: 40
4: 546
Right 1072252758 10:93594627-93594649 AAAGAGTAGGTTTTGCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072252753 Original CRISPR ATTAATAAGCAGAATTAGGA TGG (reversed) Intronic
906334950 1:44921268-44921290 ATTAATAACCAGAATATAGAAGG - Intronic
907433353 1:54427879-54427901 ATTAAAAAACAAAATTAGCAGGG - Intergenic
907603847 1:55795677-55795699 ATTGATATGGGGAATTAGGAAGG + Intergenic
908012606 1:59795709-59795731 ATTAATAACCAGAATACAGAAGG + Intergenic
908472972 1:64462442-64462464 AAAAATAAGCAGAATTAGCCAGG - Intergenic
908604788 1:65785030-65785052 ATTAATAACCAGAATATGTAAGG + Intergenic
909914449 1:81300204-81300226 ATCAAAGATCAGAATTAGGATGG + Intergenic
910022457 1:82608744-82608766 ATAAATAAGTAGAATTAAGTAGG - Intergenic
910644367 1:89497340-89497362 ATTAATAAGCAGAATATATAAGG + Intergenic
911198383 1:95018711-95018733 ATTAAAGAACAGAATTGGGAGGG - Intronic
911267821 1:95763557-95763579 ATTAATAACCAGAATATAGAAGG + Intergenic
911396999 1:97322254-97322276 ATAAATAAAAGGAATTAGGAAGG + Intronic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
912112449 1:106359607-106359629 ACAAATAAGCAGAATTAAGATGG + Intergenic
912153983 1:106893245-106893267 ATTCACAAGCAGAATTAAGAAGG + Intergenic
916271015 1:162941429-162941451 ATGAAAAAGCAGGATAAGGAAGG - Intergenic
916355577 1:163903175-163903197 ATTAATAACCAGAATAAATAAGG - Intergenic
916571811 1:166034498-166034520 TTTAACAAGGAGAATTAGGTTGG - Intergenic
917351199 1:174079893-174079915 ATTAATAACCAGAATATGTAAGG + Intergenic
917790842 1:178497807-178497829 ATTAATAAGCAGATCGGGGAGGG + Intergenic
917873937 1:179268061-179268083 GTTAATAAGAGCAATTAGGAAGG + Intergenic
918781429 1:188704645-188704667 ATTACTAAGCAAAATTTAGAAGG - Intergenic
918797703 1:188924802-188924824 ATTAATAACCAGAATAGAGAAGG + Intergenic
919098539 1:193065467-193065489 ACTAATAAGCAGAAGTAGACAGG + Intronic
919259061 1:195166167-195166189 ATGCATAAGCAGAATTAGGCAGG - Intergenic
919269508 1:195321098-195321120 ATTAATAACCAGAATATGTAAGG - Intergenic
919337173 1:196250734-196250756 ATTAATAACCAGAATGTGTAAGG + Intronic
1062867950 10:872786-872808 GTTAATGAGCAGAATTCTGAGGG - Intronic
1063334717 10:5200237-5200259 ATAAATAAGCAGAATCAATATGG - Exonic
1065171943 10:23039665-23039687 AATAAAAAGCAAATTTAGGATGG + Intergenic
1065203974 10:23340958-23340980 ATTAATAAGCATTTGTAGGATGG - Intronic
1065253719 10:23843582-23843604 AGTAGAGAGCAGAATTAGGAAGG - Intronic
1065682229 10:28248521-28248543 ATCATTAAGTGGAATTAGGAAGG - Intronic
1067522440 10:47017900-47017922 ATTAATAACCAGAATAGGTAAGG + Intergenic
1068084447 10:52357820-52357842 ATTAAAAAACAGAGTTAGTATGG + Intergenic
1068520590 10:58073128-58073150 AATAATAATAATAATTAGGAGGG - Intergenic
1068578809 10:58715082-58715104 ATTAAAAATAATAATTAGGAGGG + Intronic
1069545371 10:69324126-69324148 ATCAATAAGCATACTTAGGGAGG - Intronic
1069983210 10:72266666-72266688 ATTAATAATTAGAATCAGGCTGG - Intergenic
1070405277 10:76088920-76088942 ACTAATGAGAACAATTAGGAGGG - Intronic
1071123607 10:82309224-82309246 ATTCATAGGCAAAATTAGGAGGG - Intronic
1071232610 10:83606269-83606291 ATTAACAAGCACAATTAGGCTGG + Intergenic
1071686740 10:87765880-87765902 ATAAATAAACAGAATTAGCCAGG + Intronic
1071883057 10:89920403-89920425 ATCAATAAGCAGTAGTAGAAAGG + Intergenic
1072252753 10:93594581-93594603 ATTAATAAGCAGAATTAGGATGG - Intronic
1072385243 10:94918547-94918569 ATTAATAACCAGAATATGTAAGG - Intergenic
1073308730 10:102524149-102524171 TTTAAAAAGAAGAATTAGGCAGG - Intronic
1074157499 10:110811668-110811690 GTTAAAAAAAAGAATTAGGAAGG - Intronic
1074202590 10:111252114-111252136 ATTAATAAGCAGAATATCTAAGG + Intergenic
1074268470 10:111929014-111929036 AAAAAAAAGCATAATTAGGAAGG + Intergenic
1074672253 10:115805105-115805127 ATTAGGAGGTAGAATTAGGAGGG - Intronic
1074804559 10:117035587-117035609 ATTAATAACCAGAATATGTAAGG + Intronic
1078045314 11:7909059-7909081 ATTAAAAAGCAGAAGTGGGGTGG + Intergenic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078154384 11:8786508-8786530 GTTAATGAACAGGATTAGGAAGG + Intronic
1078708774 11:13770222-13770244 ATTTATAAGCAGATTTACTATGG - Intergenic
1080941598 11:36924439-36924461 ATTAACAAGAGGAATGAGGAAGG + Intergenic
1081697869 11:45129424-45129446 ATTAATAAGCAAATTTGGAAAGG + Intronic
1082120087 11:48370695-48370717 ATTAGTAAGAAGAATCAGTAGGG - Intergenic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1085244301 11:75086838-75086860 ATTAATAGGCAGAACACGGAGGG - Intergenic
1086042846 11:82499729-82499751 AGCACTAAGCAGAATAAGGATGG + Intergenic
1086340097 11:85840167-85840189 ATTAATAACCAGAATATGTAAGG - Intergenic
1086871238 11:92039417-92039439 ATTATTAAGAAGTTTTAGGATGG + Intergenic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1086980011 11:93185769-93185791 ATAAATGAGCAGAATTTTGATGG - Exonic
1087174663 11:95085621-95085643 CTTAATAGGCATAATTAGAAGGG + Intergenic
1087401941 11:97678447-97678469 ATTAATAACCAGAATGTGTAAGG - Intergenic
1087460577 11:98440433-98440455 ATTAATAAGCAGAATATATAAGG - Intergenic
1087665651 11:101044600-101044622 ATGATTAAGCTTAATTAGGAAGG - Intronic
1087900118 11:103631017-103631039 AGAAAACAGCAGAATTAGGAAGG + Intergenic
1088154617 11:106788267-106788289 ATTAATAACCAGAATATGTAAGG - Intronic
1088323508 11:108577919-108577941 ATTAATAACCAGAATATGTAAGG - Intronic
1088341326 11:108771232-108771254 ATTAATAACCAGAATATAGACGG - Intronic
1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG + Intronic
1089917644 11:122173872-122173894 AATAACAAGCAAAATTAGAATGG - Intergenic
1090145433 11:124316485-124316507 ATTAATAAGCAGAATATATAAGG - Intergenic
1090164045 11:124528044-124528066 ATTAATAATCAGAATATGTAAGG - Intergenic
1091444845 12:538728-538750 ATCAATGAGGAGAATAAGGAAGG + Intronic
1091966628 12:4748099-4748121 ATTAATAACCAGAATATGCAAGG - Intronic
1092216013 12:6683317-6683339 ATTAAAAATAATAATTAGGAGGG + Intronic
1092766686 12:11859435-11859457 ATTAAGAAGCAGATTCAGGCCGG - Intronic
1093236829 12:16619699-16619721 ATTAAGAAGCAGCTTTAGGTTGG + Intergenic
1093384515 12:18535562-18535584 TTCAATAAGGAGAATTATGATGG - Intronic
1093620507 12:21283680-21283702 ATTAATAACCAGAATATGTAAGG + Intronic
1093859826 12:24150959-24150981 ATTTAAAAACAGAATCAGGAAGG + Intergenic
1094246860 12:28308120-28308142 ATAAATAAGAAAATTTAGGAAGG - Intronic
1094427850 12:30334463-30334485 ATAAAGAAGTAGAATTAGGCCGG + Intergenic
1094554071 12:31481101-31481123 ATGAATAATGAGTATTAGGATGG - Intronic
1094636782 12:32234299-32234321 TTTAAAAAGCAAAATTAGGCAGG + Intronic
1095398853 12:41791688-41791710 TTTAAAAAGTAGGATTAGGATGG - Intergenic
1096891184 12:54773282-54773304 ATTAATAATCAGAATTTATAAGG - Intergenic
1098240035 12:68457631-68457653 ATTAATAACCAGAATACGTAAGG + Intergenic
1099139144 12:78948541-78948563 ATTAATAAGCAGAATGAATATGG - Intronic
1099288798 12:80749200-80749222 ATACATATGCACAATTAGGAAGG - Intergenic
1100294334 12:93246802-93246824 TTTAATAAGAAGATTTAAGATGG - Intergenic
1100318132 12:93464574-93464596 AAAAATAAACAGAATTAGTAAGG - Intergenic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1100889168 12:99104783-99104805 AGTGATAAACAGAACTAGGAAGG - Intronic
1101786688 12:107890176-107890198 ATTTATAAGAAAAATTAGGCTGG - Intergenic
1101792924 12:107946493-107946515 ATTAATAATCAGAATTTATAAGG + Intergenic
1102089030 12:110170826-110170848 ATTTATAAGCAGCTTTAGAAAGG + Intronic
1102293054 12:111716556-111716578 TTTAATAATAAGAATTTGGAAGG + Intronic
1103460729 12:121102711-121102733 ATTAATAACCAGAATATGTAAGG + Intergenic
1103680663 12:122690966-122690988 AATAACAAGCAGAAAGAGGAAGG - Intergenic
1105335930 13:19468900-19468922 ATTAATAACCAGAATATGTAAGG - Intronic
1105460034 13:20576249-20576271 ATTAATAACCAGAATATGTAAGG - Intronic
1105721096 13:23115307-23115329 ATTGATCATCAGAATTAGGCAGG - Intergenic
1107180854 13:37457369-37457391 GTTAATAATTAGAATTATGATGG - Intergenic
1107201717 13:37728315-37728337 ATTAATAAACAAAATCAGCAAGG + Intronic
1107372072 13:39763210-39763232 ATTAATAAGTAAATTTAGCAAGG - Intronic
1107440525 13:40423354-40423376 GTTGATAAGTAAAATTAGGAAGG - Intergenic
1107608808 13:42091686-42091708 ATTAATAACCAGAATATGGAAGG + Intronic
1107754540 13:43605918-43605940 ATTAATAACCAGAATACAGAAGG + Intronic
1108420610 13:50245311-50245333 ATGAAGAAGCAGAATTAGAGAGG - Intronic
1108833657 13:54511895-54511917 ATTTTTAATCAGAATTAAGAAGG + Intergenic
1108878736 13:55082423-55082445 ATTAATAACCAGAATGCAGAAGG - Intergenic
1109214818 13:59577605-59577627 ATTAATAACCAGAATAAACAAGG + Intergenic
1110086036 13:71381036-71381058 ATTAAGAAACAGAATTAGCCAGG + Intergenic
1110428450 13:75395954-75395976 ATTTATAAGCAGGATCAGGTTGG + Intronic
1110522716 13:76499551-76499573 ATTAATAAGCTGGATAAAGAAGG + Intergenic
1110861241 13:80346718-80346740 ATTAAGAAGTATAATTAGGCCGG + Intergenic
1110949779 13:81471299-81471321 ATTAATAACCAGAATATGTAAGG + Intergenic
1110980579 13:81891549-81891571 ATTAATAATCAGAATTTATATGG + Intergenic
1111307072 13:86428487-86428509 ATGAATAAGAAGAATCAGTATGG - Intergenic
1111349524 13:87008997-87009019 GCTAATAAGAAGAATTGGGAGGG + Intergenic
1112263232 13:97897744-97897766 ATTAATAACCAGAATATAGAAGG - Intergenic
1112419630 13:99236324-99236346 ATTAGTAACCAGAATTTGTAAGG + Intronic
1112504220 13:99965932-99965954 ATTAGGAAGAAGAATTAGGCTGG - Intronic
1113432468 13:110262529-110262551 AATAAAAAGTAGAATTAAGAGGG - Intronic
1115008510 14:28515859-28515881 TTTGATATGCAGAATTAGGAAGG + Intergenic
1115104745 14:29746712-29746734 AATAATGAACAGAATTGGGAAGG - Intronic
1115885021 14:37961694-37961716 GTTAATATTCAGAGTTAGGAGGG + Intronic
1116054397 14:39845179-39845201 ATTAATGAGGGAAATTAGGAAGG + Intergenic
1116521754 14:45857122-45857144 ATAAGTTAGCAGAATTAGTAAGG - Intergenic
1117326983 14:54678374-54678396 AGAAAACAGCAGAATTAGGAAGG - Intronic
1117819833 14:59636600-59636622 ATTAATAAGTAAATTTAGCAAGG - Intronic
1117885310 14:60355239-60355261 ATTAATAAGCATAATAATAATGG + Intergenic
1117888756 14:60394482-60394504 ATTAATAACCAGAATAAATAGGG - Intergenic
1118070433 14:62241174-62241196 ACTACTAAGCAGAATAAAGAAGG + Intergenic
1118418518 14:65572670-65572692 ATCATTAAGCAGACTTAGCAAGG + Intronic
1118605307 14:67498598-67498620 AGGAATGAGCAGAATTAGGGTGG + Intronic
1118949655 14:70423261-70423283 ATTAATAACCAGAATATGTAAGG + Intergenic
1119585992 14:75835658-75835680 ATTAATAATCAGAATATGTAAGG + Intronic
1121242079 14:92438457-92438479 AATAATAAACAGAATTAGCTGGG + Intronic
1121619363 14:95335594-95335616 ATTATTAAGCAAAATGAGGGAGG - Intergenic
1121820914 14:96965216-96965238 ATTAAAAAGCAGAATTACCCAGG - Intergenic
1123165533 14:106322253-106322275 ATTAACAGACAGAATTATGAAGG - Intergenic
1202840626 14_GL000009v2_random:117678-117700 CTTAATAACCATAATTAGGGTGG - Intergenic
1202910005 14_GL000194v1_random:107876-107898 CTTAATAACCATAATTAGGGTGG - Intergenic
1202882599 14_KI270722v1_random:74922-74944 CTTAATAACCATAATTAGGGTGG + Intergenic
1202933000 14_KI270725v1_random:56571-56593 ATTAAGAAGCAGAACTTGGCCGG + Intergenic
1124021344 15:25927364-25927386 ATTCAAAAGTAAAATTAGGATGG - Intergenic
1124245234 15:28064535-28064557 ATTCAACAGCAGATTTAGGAAGG - Intronic
1124992164 15:34685835-34685857 AATAATATGGAGAAGTAGGATGG + Intergenic
1125153389 15:36559766-36559788 ATTAAAAACCAGAATATGGAAGG - Intergenic
1125636267 15:41191220-41191242 ATTAAAAAGCAGTCTTAGGCCGG - Intronic
1126219830 15:46199779-46199801 ATTAATAACCAGAATATAGAGGG - Intergenic
1126262333 15:46708428-46708450 ATTTGTAAGCAGAATGAAGATGG - Intergenic
1126630869 15:50733775-50733797 ATTAATAACCAGAATATGTAAGG + Intronic
1126934588 15:53692340-53692362 ATTATTGAGCACAATTAGAATGG + Intronic
1127155373 15:56119069-56119091 ATTAATAACCAGAATATAGAAGG - Intronic
1127406871 15:58658828-58658850 ATCAATAAGCAGACTTATCAAGG - Intronic
1127459508 15:59185168-59185190 ATTAATAACCAGAATATAGAAGG - Intronic
1128740145 15:70078187-70078209 AAAAATAAGCAGAGTGAGGAAGG - Intronic
1129930902 15:79410294-79410316 ATTAATATCCTGAATTAGAATGG - Intronic
1130028280 15:80288977-80288999 ATTAATAAGTATAATTGGAAGGG + Intergenic
1130065661 15:80602870-80602892 ATTAATAAGCTGTATTTGGAGGG + Intergenic
1130299716 15:82670808-82670830 ATTAATAACCAGAATACGTAAGG + Intronic
1132022912 15:98379620-98379642 ACTAATAAGCAATATTAGCAAGG + Intergenic
1132124005 15:99204363-99204385 ATTAATAACCAGAATAAATAAGG - Intronic
1132438826 15:101838263-101838285 ATTAATAACCAGAATATGTAGGG - Intergenic
1133068286 16:3226349-3226371 ATTAAAAAGAATAATTAGGTCGG - Intronic
1134688351 16:16174356-16174378 ATTAATAGACAGAAAAAGGAAGG - Intronic
1134907231 16:17990514-17990536 ATTAATAAGCAGACATATAATGG + Intergenic
1137851129 16:51744727-51744749 ATTAATAACCAGAATATGTAAGG + Intergenic
1137858751 16:51823920-51823942 ATAAATATGTAGAATTAGAATGG + Intergenic
1138072878 16:54010450-54010472 ACTAATATGAAGAGTTAGGATGG - Intronic
1138852151 16:60641965-60641987 ATGAATCAGCAGAGTTAGGAAGG + Intergenic
1139042000 16:63009047-63009069 ATAGAAAAGAAGAATTAGGAAGG + Intergenic
1139195438 16:64913138-64913160 CTTAAAAAGCAGAATAAGCAGGG - Intergenic
1141226850 16:82125324-82125346 ATTAATAACCAGAATTTATAAGG + Intergenic
1141418206 16:83893580-83893602 ATTAAAAAGGATAATTATGAAGG + Intergenic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1146757693 17:35448178-35448200 GTTAAAAAGCAGAATTAGGCCGG - Intronic
1147593114 17:41698292-41698314 ATTAAAATGCAGATTTAGGCCGG + Intergenic
1147709371 17:42451473-42451495 ATTAAAAAGCAGACTTTGGCCGG + Intergenic
1149345294 17:55728445-55728467 ATTACTAAGCAGATTTGGGTAGG + Intronic
1150192053 17:63253320-63253342 ATTAATAAGCAGAATGTATAAGG - Intronic
1150316590 17:64174377-64174399 ACTAGTAAGCAGAATGGGGAGGG + Intronic
1150317428 17:64181179-64181201 TTTAAAAAGCAAAATTAGGCCGG + Intronic
1150518537 17:65840771-65840793 ATTAATAACCAGAATTTATAAGG + Intronic
1150588036 17:66535967-66535989 AATAATCAGGAGAATAAGGAGGG - Intronic
1150854610 17:68739983-68740005 ATTAATAAGTAAATTTAGCAAGG + Intergenic
1151193405 17:72414882-72414904 ATTAATAAGAACAAATAGGCCGG - Intergenic
1151503270 17:74506586-74506608 ATTAATAACCAGAATATGTAAGG - Intergenic
1152328044 17:79653669-79653691 AAGAATAGGCAGAAGTAGGAAGG + Intergenic
1152774469 17:82191962-82191984 ATAAAAAAGTAGAATTAGGTTGG - Intronic
1153511563 18:5860066-5860088 ATTAATAACCAGAATATGTAAGG + Intergenic
1153739048 18:8103826-8103848 ATTATTAAGCACAGTGAGGAAGG - Intronic
1153970173 18:10218881-10218903 ATTCATACACAGAATTAGAAGGG - Intergenic
1155101613 18:22615988-22616010 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1155360359 18:24993573-24993595 ATTATTACGTAGAATTAGAAGGG + Intergenic
1155455184 18:26004664-26004686 TTTAATAAGCAGTTTTAGGGAGG - Intergenic
1156060693 18:33072115-33072137 ATTAGTAACCAAAATTAGAAGGG - Intronic
1156535158 18:37855880-37855902 ATTAATAACCAGAATATGTAAGG - Intergenic
1156768086 18:40683929-40683951 AATAAAAAGAAGAACTAGGAAGG - Intergenic
1156775702 18:40785836-40785858 ATTAATGAGGAGAATTAGCATGG + Intergenic
1157154514 18:45252847-45252869 ATTAAAAAGCATGATTAGGCTGG + Intronic
1157841564 18:50964036-50964058 ATTAATAACCAGAATTTATAAGG + Intergenic
1157864766 18:51171830-51171852 ATTAATATGGAGCATGAGGATGG - Intergenic
1158163390 18:54511462-54511484 ATTAATAACCAGAATAAATAAGG + Intergenic
1158312775 18:56176727-56176749 ATTAGTAAGCAGTATAAGCATGG - Intergenic
1159173072 18:64797926-64797948 ATGAATAAGCTTAATGAGGAAGG + Intergenic
1159293707 18:66454211-66454233 ATTACAAATCAGAGTTAGGAGGG + Intergenic
1160467308 18:79090652-79090674 ATTAATAATCAGAATTTATAAGG - Intronic
1163096809 19:15064627-15064649 CTTTATTAGCAGAATGAGGATGG - Intergenic
1165501904 19:36196224-36196246 ATTAAAAATCAAAATTAGGCTGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166227343 19:41404583-41404605 ATTAATAAATAAAATTAGGCTGG - Intronic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1167023980 19:46900978-46901000 ATTACAAAGCAAACTTAGGAGGG - Intergenic
1167788172 19:51652788-51652810 ATTAATAACCAGAATACGTAAGG + Intergenic
1167806393 19:51789262-51789284 ATCAAAAAGGAGAAATAGGAAGG + Intronic
1167977246 19:53239414-53239436 ATAAAGATGAAGAATTAGGAGGG + Intronic
1168114849 19:54216604-54216626 ATTAAGAAGCATAAATAGGCCGG - Intronic
1202631838 1_KI270706v1_random:7196-7218 CTTAATAACCATAATTAGGGTGG + Intergenic
1202658199 1_KI270708v1_random:43911-43933 CTTAATAACCATAATTAGGGTGG + Intergenic
925333484 2:3076326-3076348 ATTAAGGAGCATAATCAGGAGGG + Intergenic
925901797 2:8514116-8514138 GATGAGAAGCAGAATTAGGATGG + Intergenic
927493737 2:23538134-23538156 AATAAGTAGCAGAACTAGGATGG + Intronic
928162837 2:28944715-28944737 ATTAGTAAGCAAAATAAGGGTGG + Intronic
928643858 2:33330229-33330251 ATTAACAAGCAGATTTAGCAAGG - Intronic
928845863 2:35671052-35671074 ATTAATAAGCAGAATATATAAGG - Intergenic
929500988 2:42491956-42491978 AGGAATAAGCAGACTAAGGATGG - Intronic
930315347 2:49790654-49790676 ATAAATAAATAGAATTAAGATGG - Intergenic
930720646 2:54634446-54634468 ATCAATAAGCATAATAAAGATGG + Intronic
930977363 2:57479584-57479606 ATTAATTAACAGATTTATGAAGG - Intergenic
931568436 2:63641672-63641694 ATTAATAACCAGAATAAGTAAGG - Intronic
931572791 2:63687443-63687465 ATTAATAACCAGAATATGTAAGG + Intronic
931601345 2:64006467-64006489 ATTAGGAAACAGACTTAGGAAGG - Intronic
931803069 2:65777689-65777711 ATTATTAAGCTGATTTGGGATGG + Intergenic
931848420 2:66228706-66228728 GTTAATAAGCAGAAATAAAAGGG - Intergenic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
934101976 2:88661746-88661768 TTTAATAGGCAGAATTAGAAAGG - Intergenic
934145667 2:89091269-89091291 AACAATAAGCTGAATAAGGATGG - Intergenic
934155131 2:89192157-89192179 ATAAAGAAGAAGAATTAGAAAGG - Intergenic
934212183 2:89990570-89990592 ATAAAGAAGAAGAATTAGAAAGG + Intergenic
934223589 2:90109301-90109323 AACAATAAGCTGAATAAGGATGG + Intergenic
937125146 2:119470342-119470364 TTTAATAATAAGAAATAGGATGG + Intronic
937666628 2:124495393-124495415 ATTAAAAAGTAGATTTGGGAGGG + Intronic
937745335 2:125405527-125405549 ATTAATAAGCAGAATGTATACGG - Intergenic
939190718 2:138913770-138913792 ATTAATAATCTGAACTAGTATGG + Intergenic
939263643 2:139842954-139842976 ATTAATAACCAGAATATGTAAGG + Intergenic
939404708 2:141741673-141741695 ATTAATAACCAGAATATGTAAGG - Intronic
939459159 2:142476769-142476791 ATGAAGAAGCAGATTTAGGCTGG - Intergenic
939625038 2:144466637-144466659 ATTAATAAGCTGAATAATAAGGG + Intronic
939935811 2:148292327-148292349 ATTAATAACCAGAATATGTAAGG + Intronic
940689449 2:156897013-156897035 CTTGATAAGCAGAATTTGTAAGG + Intergenic
940831553 2:158472311-158472333 TTTAAAAAGTAGAATTAGGCCGG + Intronic
940935695 2:159491909-159491931 AATAAAAAGAAGAATTAGGATGG - Intronic
941234286 2:162949893-162949915 ATTAATAACCAGAATATAGAAGG + Intergenic
941348527 2:164401780-164401802 ATTAATAACCAGAATATGTAAGG + Intergenic
941361787 2:164560574-164560596 ATTAATAAGAAGGATTGGGGGGG + Intronic
941562238 2:167060983-167061005 ATATATAAGCATAAATAGGAAGG - Intronic
941854450 2:170216465-170216487 AGTAAAAAGCATAATTGGGATGG + Intronic
941874698 2:170420815-170420837 TCTAAAAAGCAGAATTAGCATGG - Intronic
942166581 2:173246619-173246641 ATTCAAAAGCAGAATTAGGAAGG + Intronic
943117083 2:183686222-183686244 ATTAATAACCAGAATACAGAAGG - Intergenic
943489021 2:188526499-188526521 ATTAATTAGAAATATTAGGAAGG + Intronic
943686611 2:190825156-190825178 ATTAATAAACAAATTTAGTAGGG - Intergenic
943698796 2:190966736-190966758 ATTAGCAAGTAAAATTAGGAAGG - Intronic
943851660 2:192730812-192730834 ATTAATAAGTAGAAGCATGAAGG + Intergenic
945323078 2:208449498-208449520 AGAAATAACCAGAATTAGGTAGG + Intronic
945378424 2:209108698-209108720 ATTAATAAGCAGAATATATAAGG + Intergenic
945881813 2:215332335-215332357 ATTACTAAGCAGGATCAGTAAGG - Intronic
946744695 2:222833893-222833915 ATTAATTAGCAGCATTGGGCCGG + Intergenic
947013696 2:225593763-225593785 ATTAATAGGCACACTTAAGAAGG + Intronic
947182303 2:227422010-227422032 ATTAAGAAGCAAAATGAGGCTGG - Intergenic
947223392 2:227816872-227816894 ATTAATGAGCTGAGTTAGGTTGG + Intronic
947584864 2:231348694-231348716 ATTAATAATCAGAATTAAAAAGG + Intronic
947804526 2:232956469-232956491 TTTAAGAACCAGAATTAGGCTGG + Intronic
1169484894 20:6020926-6020948 CTTAAAAAGCAGGATTAGGCCGG - Intronic
1169793021 20:9431442-9431464 AATTAAAAGCAGAATTAAGAGGG - Intronic
1169887618 20:10417919-10417941 TTTAAAAGGCAGATTTAGGAGGG + Intronic
1170236498 20:14111470-14111492 ATTAATAACCAGAATATGTAAGG + Intronic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1171335310 20:24380179-24380201 ATTAATAACCAGAATATAGAAGG + Intergenic
1171938375 20:31298944-31298966 ATTAATAAGCAGAATATATAAGG + Intergenic
1172346705 20:34207408-34207430 ATTAATAACCAGAATATGTAAGG - Intronic
1173394315 20:42664060-42664082 GTTAATAAGCAGTATTGGTAAGG - Intronic
1176598148 21:8766673-8766695 CTTAATAACCATAATTAGGGTGG + Intergenic
1176629359 21:9122579-9122601 CTTAATAACCATAATTAGGGTGG - Intergenic
1176644051 21:9333068-9333090 CTTAATAACCATAATTAGGGTGG + Intergenic
1176737633 21:10566120-10566142 ATTAATAACCAGAATATGTAAGG + Intronic
1177401357 21:20609725-20609747 ATTAATAAGCAGAATATATAAGG + Intergenic
1177622438 21:23613554-23613576 ATTAATAAGTATAATGAGGTTGG - Intergenic
1178936244 21:36864489-36864511 ACTTTTAAGCAGGATTAGGATGG - Intronic
1179140896 21:38724027-38724049 GTTTGTAAGCAGAATTTGGAGGG + Intergenic
1179388696 21:40967730-40967752 ATTAATTAATAGAATTAGAATGG + Intergenic
1180368893 22:11966158-11966180 CTTAATAACCATAATTAGGGTGG - Intergenic
1180377199 22:12105016-12105038 CTTAATAACCATAATTAGGGTGG + Intergenic
1180420308 22:12808233-12808255 CTTAATAACCATAATTAGGGTGG - Intergenic
1183866738 22:40710288-40710310 CTTAAGAAGCAGTAGTAGGACGG - Intergenic
949152068 3:781328-781350 ATAAAACAGCAGAATGAGGAAGG + Intergenic
949180578 3:1125346-1125368 ATACATAAGCAAAATTTGGAAGG + Intronic
949359149 3:3213507-3213529 AATGATAAGCAAAATTTGGACGG + Intergenic
949452498 3:4201984-4202006 ATTAATAACCAGAATATGTAAGG - Intronic
951072461 3:18347700-18347722 CTTAATAAGTAGAGATAGGATGG - Intronic
951169034 3:19517348-19517370 ATAATTGACCAGAATTAGGATGG + Intronic
951348194 3:21572121-21572143 ATTAATGAGCTGAGTCAGGATGG - Intronic
951598464 3:24344078-24344100 TTAACTAAGCTGAATTAGGAGGG + Intronic
952588356 3:34920506-34920528 ATTAAGAAGGAGAATGAGAATGG - Intergenic
952990741 3:38828998-38829020 ATTAATTCCCAGAATGAGGATGG + Intergenic
954008431 3:47612741-47612763 AGTAATTAGAAGAATTAGAAAGG + Intronic
954994507 3:54869355-54869377 TTAAAGAAGCAGAATTAAGAAGG + Intronic
955452446 3:59084228-59084250 CTTAATAAGCACACTAAGGATGG - Intergenic
956098195 3:65739556-65739578 ATGATTAAGCTGAATGAGGAAGG - Intronic
956601505 3:71027810-71027832 ATTAATAAACATACTTAGTAGGG + Intronic
956740719 3:72273669-72273691 TTTAAGAAACACAATTAGGAAGG + Intergenic
957095697 3:75775258-75775280 CTTAATAACCATAATTAGGGTGG - Intronic
957230617 3:77509510-77509532 GTTAATATTCAGAATTGGGAGGG + Intronic
957253736 3:77810220-77810242 ATTAATAAGTATATTTAGCAAGG + Intergenic
957745367 3:84334058-84334080 ATTAATAAGCAGAATAAATAAGG + Intergenic
957866490 3:86031086-86031108 ATGAATAAACAGACTTAGGAAGG + Intronic
957867783 3:86046783-86046805 ACTAATAAGCACAATGAGGGGGG - Intronic
958084048 3:88782685-88782707 ATTAATAACCAGAATAAATAAGG + Intergenic
958507746 3:95002735-95002757 ATGATTAAGCACAATTAGAATGG + Intergenic
958715056 3:97770418-97770440 ATTAATAACCAGAATACAGAAGG - Intronic
959234016 3:103694370-103694392 ATTGAGCAGGAGAATTAGGAAGG + Intergenic
959577719 3:107952286-107952308 ATTTAGAAGAAGAATAAGGAGGG + Intergenic
960036002 3:113103772-113103794 TTTCATAAGCAGAATAAGCAAGG + Intergenic
960781065 3:121317980-121318002 ATAAATAAGAAGAATTAGAAGGG - Intronic
960866645 3:122208329-122208351 ATTAATAAGAAAATTTAGGCTGG - Intronic
962103789 3:132369958-132369980 ATTAATAATCACAATTGGGGTGG - Intergenic
963018040 3:140844513-140844535 ATTAACAGGCATAATCAGGAAGG + Intergenic
963096441 3:141546570-141546592 ATTAATAACCAGAATATGTAAGG - Intronic
963216903 3:142758521-142758543 ATTAATAACCAGAATATGTAAGG - Intronic
964074434 3:152676180-152676202 AATAAAAATCAGAGTTAGGATGG + Intergenic
964084034 3:152794643-152794665 TTTAAAAAGCAAAATTAGGCTGG - Intergenic
964568198 3:158081513-158081535 ATTTACCAGCAGAATTAGTAAGG - Intergenic
965373054 3:167888870-167888892 ATTAAAAAGCAGGCTAAGGAAGG - Intergenic
966331161 3:178815418-178815440 ATTAATAAGAAAATTTAGGCTGG - Intronic
1202742838 3_GL000221v1_random:72000-72022 CTTAATAACCATAATTAGGGTGG - Intergenic
968738096 4:2309498-2309520 AATAATAAGTAGATTTAGCAAGG - Intronic
969234710 4:5857697-5857719 ACTAGTAAGCAGAAGAAGGAAGG + Intronic
970363849 4:15337987-15338009 ATTTATAAACAGAAATAAGAGGG - Intergenic
971105144 4:23516392-23516414 ATTAATAACCAGAATAATTAAGG - Intergenic
971284336 4:25272981-25273003 GTTAATAAGCAAAATTGGAAGGG - Intronic
972915343 4:43870324-43870346 ATTAATAACCAGAATATGTAAGG - Intergenic
972945319 4:44247195-44247217 AATAAAAAGCAGATTTAGGGAGG - Intronic
973059666 4:45705934-45705956 ATTACTAAGAAGAAATAGCAAGG - Intergenic
973361469 4:49169040-49169062 CTTAATAACCATAATTAGGGTGG + Intergenic
974290516 4:59923810-59923832 ATTAATAACCAGAATATAGAAGG + Intergenic
974698867 4:65411930-65411952 AATAATAAGCAAAATTAGGCTGG + Intronic
975157023 4:71083477-71083499 CTTAATAATCAGAATCAGGAAGG - Intergenic
975403730 4:73965918-73965940 ATTAAAAAGGAGAATTTGGGAGG - Intergenic
975463152 4:74678207-74678229 ATTAATAACCAGAATATGTAAGG - Intergenic
975651062 4:76593694-76593716 TTTAATAAGCAGATCTTGGAAGG - Intronic
975977361 4:80114713-80114735 ATTAATACGCAGAATTTATAAGG - Intronic
976135228 4:81928951-81928973 ACTAACAAACAGAATTTGGAGGG - Intronic
976323404 4:83743018-83743040 ATTAATAACCAGAATTTATAAGG - Intergenic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
977328085 4:95602438-95602460 AATATTAAACAAAATTAGGAAGG + Intergenic
977377972 4:96232515-96232537 ACTAATAAGCAAATATAGGAAGG + Intergenic
977873158 4:102117728-102117750 ATTAATGAGCAGAATATAGAAGG - Intergenic
978098405 4:104807448-104807470 ATTAATAACCAGAATATGAAAGG + Intergenic
978684845 4:111428046-111428068 ATTAATAACCAGAATTTATAAGG + Intergenic
979413998 4:120413835-120413857 ATAATTAAGCAGAAGTAGAAGGG + Intergenic
980029564 4:127811550-127811572 ATTGAGAAGCAAAATTTGGAAGG + Exonic
980068770 4:128219823-128219845 ATAAATAAATGGAATTAGGAAGG + Intronic
980243675 4:130209004-130209026 AATAATAAGCAGAATTATTAGGG + Intergenic
980295446 4:130909081-130909103 ATTAATAAGCAGAATACATAAGG + Intergenic
980394714 4:132196223-132196245 AATAATATTCAGAATTAGGCTGG - Intergenic
981826222 4:148944594-148944616 ATTATTATGCAGATTTATGAAGG - Intergenic
981954767 4:150456554-150456576 ATTAATAACCAGAATATGTAAGG - Intronic
982511992 4:156294321-156294343 ATTAATAAGCAGTATTAATGAGG - Intergenic
982525346 4:156470939-156470961 ATTCAGAAGCAGAAGAAGGAAGG + Intergenic
982556468 4:156872683-156872705 ATTATTCAGCAGAATTAGCATGG - Intronic
982689757 4:158534541-158534563 ATTAATAATCAGAATAAGGCCGG - Intronic
982876044 4:160651244-160651266 ATTATTAAGCTAAATGAGGAAGG + Intergenic
983000009 4:162402304-162402326 AATAATAAGAAATATTAGGATGG + Intergenic
984005387 4:174299879-174299901 ATGAAGAAACAGAATTATGAAGG - Intronic
984407792 4:179355694-179355716 ATTAATAAGTAAAATTAGGCTGG - Intergenic
984529021 4:180892838-180892860 ATTAATAAGCAAAATGAATATGG + Intergenic
1202758804 4_GL000008v2_random:90479-90501 CTTAATAACCATAATTAGGGTGG + Intergenic
985556296 5:559813-559835 AATAATAAGAAGAATTAGCCAGG - Intergenic
985837146 5:2279963-2279985 AATTATAATCAGAATCAGGAAGG - Intergenic
985870895 5:2555992-2556014 TTTAAAAAGCAGAATGAGAATGG - Intergenic
986327874 5:6691532-6691554 ATCAATAAGCAAATTTAGCAAGG - Intergenic
986889419 5:12283468-12283490 ATAAATATGCAGAAATAAGATGG - Intergenic
987601716 5:20080521-20080543 ATTAATAACCTGAGTTAGGTGGG - Intronic
987895299 5:23938176-23938198 ATTAATAACCAGAATATGTAAGG - Intergenic
988281015 5:29147559-29147581 CTAAATGAGCAGAATTATGAGGG + Intergenic
988431434 5:31123479-31123501 ATATATAAGCAAAATTAGCAAGG + Intergenic
989082830 5:37642868-37642890 ATTAATAACCAGAATAGGTAAGG - Intronic
989786162 5:45333368-45333390 ATTAATAACCAGAATTTATATGG - Intronic
989970275 5:50515610-50515632 ATTAATAACCAGAATATGTAAGG - Intergenic
990700523 5:58470363-58470385 ATTAATAACCAGAATATAGAAGG - Intergenic
990921176 5:60969602-60969624 ATTAATAACCAGAATATAGAAGG - Intronic
991136055 5:63183710-63183732 ATTATCAAGCAGCATTATGAAGG - Intergenic
991329556 5:65479100-65479122 ATAAATAACCAGAGTTAAGATGG - Intronic
991681117 5:69140509-69140531 ATTAATAACCAGAATATGTAAGG - Intergenic
992410900 5:76504381-76504403 AGTAGTAATAAGAATTAGGAAGG - Intronic
992672095 5:79070510-79070532 GTGACTAAGCAAAATTAGGAAGG + Intronic
992979287 5:82151029-82151051 ATTATTAAACAAAATTATGAAGG - Intronic
993277194 5:85875557-85875579 AATAATGAGCAGAATTTGTAAGG + Intergenic
994026149 5:95086842-95086864 ATTAATAATCAGATATAGGAAGG - Intronic
994157157 5:96516481-96516503 TTTATCATGCAGAATTAGGAAGG + Intergenic
994217421 5:97153517-97153539 ATTAATAACCAGAATAAATAAGG - Intronic
995116783 5:108490002-108490024 ATTAATAAGCAGAATATATAGGG + Intergenic
995289617 5:110436336-110436358 ATTAATAACCACAATAAAGAAGG - Intronic
996428234 5:123338824-123338846 ACTAATAAGTAGATTTAGCAAGG - Intergenic
996688218 5:126308670-126308692 ATTAATAAGCAGAATACATAAGG + Intergenic
997002523 5:129779021-129779043 ATTAATAAGCAGAATATATAAGG + Intergenic
997281209 5:132647277-132647299 ATGAAGAAGCAGATTTTGGATGG - Intergenic
997402963 5:133616738-133616760 ATGAATATGCAGTATTATGATGG + Intergenic
998185917 5:139980077-139980099 AGTGATAAGCAGAAATAGCATGG - Intronic
998274370 5:140738306-140738328 AATAAAAAGAAGAATAAGGAAGG - Intergenic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
998921842 5:147077718-147077740 TTTAAAAAGAAGAATTAGGTTGG - Intronic
998970382 5:147584818-147584840 AGTAATATTCAGAATAAGGATGG + Intergenic
1000507640 5:162141331-162141353 ATTAAAAAGCAAAATTTGGCTGG - Intronic
1000572592 5:162934059-162934081 ATTCATAAGAAGGAATAGGAGGG - Intergenic
1000572875 5:162936469-162936491 ATTAATAACCAGAATATGTAAGG - Intergenic
1000870839 5:166575130-166575152 ATTAAAAAGCTGAATGGGGAGGG + Intergenic
1001236581 5:170034878-170034900 ATTAATTATCAGATATAGGATGG - Intronic
1003275613 6:4648005-4648027 ATTTATAAGCAGAGTTAAAAAGG - Intergenic
1003994771 6:11528907-11528929 ATTAATAAGCACAATTTATAAGG + Intergenic
1004661236 6:17711512-17711534 AATAATAACCAAATTTAGGAAGG + Intergenic
1006492867 6:34399589-34399611 ATTAATAAGTGAAATTAGGCTGG + Intronic
1008249774 6:49225948-49225970 ATTAATAACCAGAATAAATAAGG - Intergenic
1008300716 6:49835865-49835887 ATTAAAAAGCACATATAGGATGG + Intronic
1009371670 6:62911617-62911639 ATTAATAACCAGAATATGTAAGG + Intergenic
1009568581 6:65348601-65348623 ATTAATAACCAGAATACAGAAGG - Intronic
1009627489 6:66154471-66154493 ATTAATAACCAGAATATAGAAGG + Intergenic
1009832240 6:68953078-68953100 ATTTCTATGAAGAATTAGGAAGG - Intronic
1010140110 6:72603823-72603845 ATTAATAAACAGAATATGTAAGG - Intergenic
1010201486 6:73285988-73286010 ATAAATAATCACATTTAGGAAGG + Intronic
1010867588 6:80998393-80998415 ATAAATAAGCACAATAAGGAAGG + Intergenic
1011322375 6:86110190-86110212 ATTAATAAGCAGAATTTATAAGG - Intergenic
1012965056 6:105665122-105665144 ATGAATAAGCTTAATGAGGAAGG - Intergenic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013563082 6:111326245-111326267 ATTAATAACCAGAATATGTAAGG + Intronic
1014344288 6:120248268-120248290 ATTAATAACCAGAATATGCAAGG + Intergenic
1014407734 6:121071405-121071427 ATTAATAAGCAGAATACGAAAGG + Intergenic
1015326877 6:131933478-131933500 ATTAAGAAGGAGAATGAGGGTGG + Intergenic
1015342779 6:132121075-132121097 ATTACTTAGCAGAATAAGCAAGG - Intergenic
1015725840 6:136298493-136298515 ATAAACAAGAAGAATAAGGATGG + Intergenic
1015959913 6:138637507-138637529 ATTAATAACCAGAATATGTAAGG + Intronic
1016065093 6:139673730-139673752 ATTAATAACCAGAATATGTAAGG + Intergenic
1016294208 6:142556740-142556762 ATTAATAACCAGAATATGCATGG + Intergenic
1017365838 6:153636546-153636568 ATTAATAACCAGAATAAATAAGG - Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017702816 6:157092204-157092226 ATTGCTAAGCAGCATTTGGAAGG - Intronic
1018348550 6:162929457-162929479 ATTAATAACCAGAATTATAAGGG - Intronic
1018691716 6:166350737-166350759 ATTATTAAGCATATTGAGGAAGG - Intergenic
1019025323 6:168957438-168957460 ATAAATAAGCATAATTATGCTGG + Intergenic
1019066728 6:169307782-169307804 ATTAATAACCAGAATATGCAAGG + Intergenic
1019725684 7:2601239-2601261 AGTGAGAGGCAGAATTAGGATGG - Intronic
1020623514 7:10547928-10547950 AATAATAAGCCTAATTTGGATGG - Intergenic
1020730957 7:11879412-11879434 ATTAATAACCAGAATATAGAAGG + Intergenic
1021179184 7:17486569-17486591 ATAATTAAGCAGAAATAGAAAGG - Intergenic
1021267960 7:18548002-18548024 ATGATTAAGCTGAGTTAGGAAGG - Intronic
1022350889 7:29565450-29565472 AGTAAAAGGAAGAATTAGGATGG + Intronic
1022740605 7:33116909-33116931 ATTAATAAGCAGAATATATAAGG - Intergenic
1023072032 7:36444661-36444683 AGAAATAAGCAGAATTAAAAAGG + Intronic
1023287289 7:38632340-38632362 ATTAATAAGAATAATAGGGATGG - Intergenic
1023884312 7:44341537-44341559 ATTAATATGCAAAATTGGCAAGG - Intergenic
1024132720 7:46372037-46372059 ATTAATAACCAGAATAAATAAGG - Intergenic
1024285538 7:47754254-47754276 ATTAATAACCAGAATATGTAAGG - Intronic
1026309103 7:69168297-69168319 ATTAAGAGCCAGAATGAGGACGG + Intergenic
1026661354 7:72305401-72305423 ATTAATAAGTTGAATATGGAAGG + Intronic
1026820339 7:73543471-73543493 ATTAATAAGAAGAATTGGCCAGG - Intronic
1027762574 7:82298764-82298786 ATTAATAAGTAAAAATAGGCCGG + Intronic
1028176206 7:87662130-87662152 ATTAATAAGCAGAATATATAAGG - Intronic
1028595301 7:92542311-92542333 ATTAATAACCAGAATATGTAAGG + Intergenic
1028716499 7:93977299-93977321 ATACATATGCAGAATTAGCAGGG + Intronic
1028971958 7:96869179-96869201 ATTAATACACAGAATGAGGTTGG + Intergenic
1030945596 7:115716350-115716372 ATAAATAAGTACAATTAGTAAGG + Intergenic
1031474927 7:122209753-122209775 ATTAATAACCAGAATATGTAAGG + Intergenic
1031686548 7:124737028-124737050 ATGAATTAGGTGAATTAGGATGG - Intergenic
1033183848 7:139207430-139207452 ATTAATAACCAGAATATAGAAGG + Intergenic
1033813764 7:145048331-145048353 ATTAATAAGCAGAATAGATAAGG - Intergenic
1034918303 7:155058986-155059008 ATTATTAAACAGAAATAGCATGG + Intergenic
1037118571 8:15255601-15255623 AATAAGAAGCATATTTAGGAAGG + Intergenic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1037872881 8:22515846-22515868 ATTAATAACCAGAATATGTAAGG - Intronic
1038680065 8:29658553-29658575 AATAATAAACAGAAATAGGCAGG - Intergenic
1038881312 8:31616304-31616326 ATAAATAAGCAGAATTATAGAGG - Intergenic
1039272318 8:35896116-35896138 ATTAATGGTCAGATTTAGGATGG - Intergenic
1039660843 8:39462908-39462930 ATTAATAACCAGAATATGTAAGG + Intergenic
1039697035 8:39923963-39923985 GTAAAAAAACAGAATTAGGAAGG - Intronic
1039755901 8:40521825-40521847 ATTCATATGCAGAATAATGAAGG - Intergenic
1040477311 8:47791178-47791200 ATTAATAAGCAAAATATGGCCGG + Intronic
1040503930 8:48029942-48029964 ATTTCTAAGTAAAATTAGGATGG - Intronic
1040606364 8:48936042-48936064 ATTAATATGCCTAATTAGCAGGG - Intergenic
1040672143 8:49704503-49704525 ATTACTAAGAAGAAATATGAGGG - Intergenic
1040910640 8:52515095-52515117 ATAAAGAAGCAAGATTAGGAAGG + Intergenic
1041050546 8:53930510-53930532 ATTAATTTCCAGAAGTAGGAAGG - Intronic
1041416479 8:57615488-57615510 ATTAATAACCAGAATATGTAAGG + Intergenic
1041603237 8:59748257-59748279 ATTAATAGGTATAATTAGCAAGG + Intergenic
1041853226 8:62417850-62417872 ATTAATAAGCAGAATATACAAGG - Intronic
1042593187 8:70418099-70418121 ATTAAGAAGTAGAAATGGGAGGG - Intergenic
1042918465 8:73898171-73898193 ATTATTATGCAAAATTAGGCCGG - Intergenic
1043580052 8:81701687-81701709 AATAATATGAAGAATTAGAAAGG + Intronic
1043770947 8:84199377-84199399 ATTAATAACCAGAATTTATAAGG - Intronic
1044032019 8:87250085-87250107 ATTAATAACCAGAATTTATAAGG + Intronic
1044134192 8:88563894-88563916 ATTAATAACCAGAATAATAAGGG + Intergenic
1044143490 8:88684351-88684373 ATTAATAACCAGAATTTATATGG - Intergenic
1045040650 8:98220702-98220724 ATCAATAAAAAGAATTAGGCTGG - Intronic
1045783133 8:105891345-105891367 ATTAATATGCAGAATATGTAAGG + Intergenic
1045820722 8:106334868-106334890 ATTTATTAGCAGTAGTAGGATGG - Intronic
1046106921 8:109677587-109677609 ATTAATAAGCTGAGGAAGGAAGG + Intronic
1046315752 8:112499821-112499843 ATTAATAAGCAGTATTGGCCAGG + Intronic
1047143810 8:122174115-122174137 ATTAATAAGTATATTTAGCAGGG - Intergenic
1047460914 8:125064515-125064537 ATTAATAAACAGAATTAAGGCGG - Intronic
1048481591 8:134800839-134800861 ATTAATAAGAAAAATTAGCCGGG - Intergenic
1048515514 8:135106025-135106047 ATTAATAAGCAGAATATATAAGG - Intergenic
1048557629 8:135496138-135496160 ATGAGAAAGCAGAAGTAGGAAGG + Intronic
1049860981 8:144898700-144898722 ATTAATAACCAGAATGCAGAAGG + Intronic
1049993748 9:1015270-1015292 ATTATTGAGCATAATTAGGGAGG - Intergenic
1050670453 9:7990804-7990826 ATAAAAGAGCAGAATTGGGAAGG + Intergenic
1050751516 9:8944011-8944033 ATTAATAACCAGAATATGTAAGG + Intronic
1051030104 9:12664212-12664234 ATTAATAACCAGAATATGTAAGG + Intergenic
1052444424 9:28542069-28542091 GGTAAGAAGCAGGATTAGGAAGG + Intronic
1052811991 9:33069502-33069524 ATTAATAACCAGAATATGGCTGG + Intronic
1053159670 9:35805381-35805403 AATAATAAGCTGATTTTGGAAGG - Intronic
1055508931 9:76975570-76975592 ATTAAGAAGCTGAATTATCAAGG - Intergenic
1056695566 9:88847555-88847577 ATGATTAAGCTGAATGAGGAAGG - Intergenic
1057419513 9:94899447-94899469 ATTAATAATTAAAATTATGAAGG + Intronic
1057504515 9:95621708-95621730 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1059973606 9:119692916-119692938 ATTAATGAGCAGATTTAGTGAGG + Intergenic
1203690601 Un_GL000214v1:38719-38741 CTTAATAACCATAATTAGGGTGG + Intergenic
1203752200 Un_GL000218v1:90258-90280 CTTAATAACCATAATTAGGGTGG - Intergenic
1203711471 Un_KI270742v1:101924-101946 CTTAATAACCATAATTAGGGTGG - Intergenic
1203539593 Un_KI270743v1:75391-75413 CTTAATAACCATAATTAGGGTGG + Intergenic
1203555106 Un_KI270743v1:200438-200460 CTTAATAACCATAATTAGGGTGG - Intergenic
1203645694 Un_KI270751v1:65472-65494 CTTAATAACCATAATTAGGGTGG - Intergenic
1186376478 X:9007548-9007570 ATTAATAACCAGAATATGTAAGG - Intergenic
1186523902 X:10230137-10230159 ATTAATAAGCAGAATATATAAGG - Intronic
1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG + Intergenic
1187286482 X:17909395-17909417 ATGAATAAGAAGAATCAGTATGG - Intergenic
1187654943 X:21461414-21461436 ATTAATAACCAGAATCTGTAAGG - Intronic
1188173764 X:26962149-26962171 GTAAATAAGCAGGATTAGGCAGG - Intergenic
1188426620 X:30054916-30054938 ATTAATAACCAGAATATGTAAGG - Intergenic
1188583568 X:31745269-31745291 ATTAGTTAGCAGAATTACGATGG + Intronic
1188815943 X:34714373-34714395 ATCAATAAGCACAGCTAGGAGGG - Intergenic
1188827158 X:34850098-34850120 ATTAATAACCAGAATATGTAAGG - Intergenic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1190365269 X:49687284-49687306 ATTAATAAGCATATTTAACAAGG + Intergenic
1190481726 X:50884142-50884164 ATAAATAAGCTGAGTTTGGAGGG - Intergenic
1190615787 X:52229388-52229410 ATTAATAACCAGAATATAGAAGG + Intergenic
1190804889 X:53825640-53825662 ATTAATAACCAGAATAAACAAGG + Intergenic
1190958726 X:55224246-55224268 ATTAATAAGCATAGTTAGAAAGG - Intronic
1190961837 X:55258250-55258272 ATTAATAAGCATATTTAGCAAGG + Intronic
1191083895 X:56544363-56544385 ATTAATAAGCAGAATATATAAGG + Intergenic
1191794653 X:65008073-65008095 ATTAATAACCAGAATACGTAAGG + Intronic
1191801358 X:65084368-65084390 ATTAATAAGCAGAATATATAAGG + Intergenic
1192070379 X:67933639-67933661 ATTAATAACCAGAATATAGAAGG + Intergenic
1192137862 X:68621084-68621106 ATTAATAACCAGAATATAGAAGG - Intergenic
1192967334 X:76192802-76192824 ATTAATAAGCAGAATATATAGGG - Intergenic
1192975777 X:76283078-76283100 ATTAATAATCAGAATATGCATGG - Intergenic
1193550228 X:82883357-82883379 ATTAATAAACAAATTTAGTAAGG + Intergenic
1193761291 X:85469602-85469624 ATTAATAAGCAGAATATATAAGG - Intergenic
1193824996 X:86213868-86213890 ATTAATATGAACAATTATGAAGG - Intronic
1193864780 X:86718358-86718380 ATTAGTAATCAGAATTTAGAAGG - Intronic
1194198191 X:90922373-90922395 ATTTATAAGCTTACTTAGGATGG + Intergenic
1194824674 X:98547042-98547064 ATTAATAAGAATAGTTGGGAAGG + Intergenic
1195402764 X:104479329-104479351 ATGAATAAACAGAATTAGATTGG - Intergenic
1195758355 X:108221152-108221174 ATAAATGAGCAGAACTGGGATGG + Intronic
1195797135 X:108663170-108663192 ACTAACAAGCATATTTAGGAGGG - Intronic
1195986218 X:110633423-110633445 ATTAATAACCAGAATAAGTAAGG + Intergenic
1196232047 X:113235031-113235053 ATTAATAAGCAGAATATATAAGG - Intergenic
1196357174 X:114808845-114808867 ATTAATAAGCAGAATGTATAAGG - Intronic
1196361587 X:114867385-114867407 ATTAATAAGCAGAATATATAAGG - Intronic
1196552206 X:117042402-117042424 ATTAATAATCAGAATATGTAAGG + Intergenic
1196700958 X:118667989-118668011 ACTAATAAGCAGATTTAGTAAGG - Intronic
1197466419 X:126809102-126809124 ATTAATAAGCAGAATATATAAGG - Intergenic
1197810580 X:130438721-130438743 ATTAATAACCAGAATATGCAAGG - Intergenic
1198096958 X:133389518-133389540 GTTAATCAGCAGAATTAGGGAGG + Intronic
1198195344 X:134355244-134355266 ATTAATGAGCAAATTTAGCAAGG + Intergenic
1199361128 X:146920343-146920365 ATTAATAACCAGAATTTATAAGG - Intergenic
1199378482 X:147140201-147140223 ATTAATAAGCAGAATATATAAGG - Intergenic
1199580978 X:149359404-149359426 ATTAATAACCAGAATAAGCTGGG - Intergenic
1200543548 Y:4490458-4490480 ATTTATAAGCTTACTTAGGATGG - Intergenic
1201165855 Y:11207888-11207910 CTTAATAACCATAATTAGGGTGG - Intergenic
1201530096 Y:14982376-14982398 ATGAATAACCAGTATTGGGATGG + Intergenic