ID: 1072253783

View in Genome Browser
Species Human (GRCh38)
Location 10:93601403-93601425
Sequence TGTGCCCGAGGCTGTCCTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 230}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072253783_1072253788 -6 Left 1072253783 10:93601403-93601425 CCTCCAGGACAGCCTCGGGCACA 0: 1
1: 0
2: 3
3: 50
4: 230
Right 1072253788 10:93601420-93601442 GGCACAGTGGAGCGGCCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 148
1072253783_1072253790 -4 Left 1072253783 10:93601403-93601425 CCTCCAGGACAGCCTCGGGCACA 0: 1
1: 0
2: 3
3: 50
4: 230
Right 1072253790 10:93601422-93601444 CACAGTGGAGCGGCCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 111
1072253783_1072253796 26 Left 1072253783 10:93601403-93601425 CCTCCAGGACAGCCTCGGGCACA 0: 1
1: 0
2: 3
3: 50
4: 230
Right 1072253796 10:93601452-93601474 GGCCAGGCCAAATGCGCCAGCGG 0: 1
1: 0
2: 1
3: 8
4: 83
1072253783_1072253792 5 Left 1072253783 10:93601403-93601425 CCTCCAGGACAGCCTCGGGCACA 0: 1
1: 0
2: 3
3: 50
4: 230
Right 1072253792 10:93601431-93601453 GCGGCCGCGCGGGGTGGCCTCGG 0: 1
1: 1
2: 0
3: 31
4: 281
1072253783_1072253794 10 Left 1072253783 10:93601403-93601425 CCTCCAGGACAGCCTCGGGCACA 0: 1
1: 0
2: 3
3: 50
4: 230
Right 1072253794 10:93601436-93601458 CGCGCGGGGTGGCCTCGGCCAGG 0: 1
1: 0
2: 3
3: 18
4: 194
1072253783_1072253791 -1 Left 1072253783 10:93601403-93601425 CCTCCAGGACAGCCTCGGGCACA 0: 1
1: 0
2: 3
3: 50
4: 230
Right 1072253791 10:93601425-93601447 AGTGGAGCGGCCGCGCGGGGTGG 0: 1
1: 0
2: 0
3: 27
4: 331
1072253783_1072253789 -5 Left 1072253783 10:93601403-93601425 CCTCCAGGACAGCCTCGGGCACA 0: 1
1: 0
2: 3
3: 50
4: 230
Right 1072253789 10:93601421-93601443 GCACAGTGGAGCGGCCGCGCGGG 0: 1
1: 0
2: 1
3: 5
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072253783 Original CRISPR TGTGCCCGAGGCTGTCCTGG AGG (reversed) Exonic