ID: 1072254158

View in Genome Browser
Species Human (GRCh38)
Location 10:93604595-93604617
Sequence CCTGTGCCTGCACTTAATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072254158_1072254165 10 Left 1072254158 10:93604595-93604617 CCCCAATTAAGTGCAGGCACAGG No data
Right 1072254165 10:93604628-93604650 GAGCAAATGTGCAGATGGAAGGG No data
1072254158_1072254166 24 Left 1072254158 10:93604595-93604617 CCCCAATTAAGTGCAGGCACAGG No data
Right 1072254166 10:93604642-93604664 ATGGAAGGGTCCTGTGCAGTTGG No data
1072254158_1072254163 5 Left 1072254158 10:93604595-93604617 CCCCAATTAAGTGCAGGCACAGG No data
Right 1072254163 10:93604623-93604645 CATGAGAGCAAATGTGCAGATGG No data
1072254158_1072254164 9 Left 1072254158 10:93604595-93604617 CCCCAATTAAGTGCAGGCACAGG No data
Right 1072254164 10:93604627-93604649 AGAGCAAATGTGCAGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072254158 Original CRISPR CCTGTGCCTGCACTTAATTG GGG (reversed) Intergenic
No off target data available for this crispr