ID: 1072255113

View in Genome Browser
Species Human (GRCh38)
Location 10:93613629-93613651
Sequence GACTGTGAATGAGAGGCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 276}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072255113_1072255119 2 Left 1072255113 10:93613629-93613651 CCCCATGCCTCTCATTCACAGTC 0: 1
1: 0
2: 2
3: 25
4: 276
Right 1072255119 10:93613654-93613676 TCGAAAACATTCAGGTTTTTTGG No data
1072255113_1072255117 -6 Left 1072255113 10:93613629-93613651 CCCCATGCCTCTCATTCACAGTC 0: 1
1: 0
2: 2
3: 25
4: 276
Right 1072255117 10:93613646-93613668 ACAGTCCTTCGAAAACATTCAGG No data
1072255113_1072255120 6 Left 1072255113 10:93613629-93613651 CCCCATGCCTCTCATTCACAGTC 0: 1
1: 0
2: 2
3: 25
4: 276
Right 1072255120 10:93613658-93613680 AAACATTCAGGTTTTTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072255113 Original CRISPR GACTGTGAATGAGAGGCATG GGG (reversed) Intronic
900208186 1:1440377-1440399 CACTGGGAATCAGAGGAATGGGG + Exonic
901638090 1:10679682-10679704 GACTGTGAAGATGAGGCAGGTGG - Intronic
903272956 1:22203149-22203171 GACTGTAACTAAGATGCATGCGG - Intergenic
904622709 1:31784925-31784947 GAGTGTGAATGAGAGACCTTGGG + Intergenic
905022820 1:34829494-34829516 GAGAGAGAATGAGAGACATGCGG + Intronic
907325066 1:53632400-53632422 GAGTGTGACTGAGGGGCATGTGG + Intronic
908110440 1:60891828-60891850 GGCTGTGAGTGAGAGGCATATGG - Intronic
911331655 1:96531406-96531428 GAATGTGAATGTGAGGCTTCAGG + Intergenic
912655673 1:111484520-111484542 AACTGTGAAGGTGGGGCATGTGG - Intronic
916748593 1:167703696-167703718 GACAGTGAAGGTTAGGCATGTGG - Intronic
917743588 1:177985648-177985670 GGCTGAGGTTGAGAGGCATGAGG + Intergenic
917754333 1:178084244-178084266 GACTGGGGATTAGAGGAATGAGG - Intergenic
920508987 1:206536807-206536829 GACTGTGAAGGCAAGTCATGAGG - Intronic
920847516 1:209606490-209606512 TTCTATGAATGATAGGCATGTGG - Intronic
921763309 1:218941434-218941456 GACAGTGAATGAGTCTCATGAGG + Intergenic
921894433 1:220384708-220384730 GGATGGGAATGAGAGGCATTGGG + Intergenic
922742216 1:228020411-228020433 GACTGTGGGTGAGAGGCCTCTGG - Intronic
922901723 1:229142428-229142450 GAATGAGACTGAGAGGCAGGAGG - Intergenic
923437481 1:233981282-233981304 GACTGTGAAGGGGCAGCATGAGG - Intronic
924942434 1:248821382-248821404 GACACTGAATCAAAGGCATGGGG + Intronic
1066187731 10:33026676-33026698 GACTGTGAGTGATTGGCATTAGG + Intergenic
1066682966 10:37953127-37953149 GCCTGTGAATGTAAGGAATGTGG - Exonic
1068611302 10:59063431-59063453 GAATGAGAATGAGAGGCTGGAGG - Intergenic
1068695770 10:59966764-59966786 AACTCTGAATGTGAGGCAAGGGG + Intergenic
1071094390 10:81956526-81956548 GTGTGTGAATGAGAGGAATCAGG - Intronic
1071152235 10:82649252-82649274 GACTGTGAAGGGGAGGCAGGAGG - Intronic
1071778602 10:88817349-88817371 GTGTGTGAAAGAGAGGGATGGGG + Intronic
1072255113 10:93613629-93613651 GACTGTGAATGAGAGGCATGGGG - Intronic
1073124612 10:101141594-101141616 GACTGTGCATGATAGGGGTGAGG + Intergenic
1073516428 10:104079520-104079542 CAGTGTGAATGAGAGTCATGTGG - Intronic
1075099061 10:119493209-119493231 GGCTGTGAATGAGGGGGAAGGGG + Intergenic
1076249171 10:128971641-128971663 AACTTTGAATGAGAGGCATGTGG + Intergenic
1076307510 10:129475385-129475407 CACAGTGCATGAGAGGCGTGAGG + Intronic
1076326321 10:129626272-129626294 GATGGAGAAGGAGAGGCATGCGG - Intronic
1078323167 11:10355221-10355243 GACAGTGAATGAGGGGGATGTGG - Intronic
1078450268 11:11435849-11435871 GACTGCGAATGTGAGGAATTGGG - Intronic
1078846342 11:15122200-15122222 GACTGTGATAGAGAGTAATGGGG + Intronic
1079075179 11:17381076-17381098 GACTGTGAAGGAAAGGCAGGGGG - Intergenic
1080323894 11:31048468-31048490 TTCTGTGAATTAGAGGCAAGGGG - Intronic
1080638380 11:34143130-34143152 GGATGTTAATGAGAGTCATGTGG + Intronic
1081292040 11:41338292-41338314 GCCTGTCATTGATAGGCATGTGG - Intronic
1081953791 11:47070999-47071021 GACTGTGACAGACAGACATGGGG - Intronic
1082798575 11:57396480-57396502 GACTTTGAATGGGAAGCATGGGG - Intronic
1084837046 11:71809995-71810017 GGCTGTAAATGAGAGGCACTGGG - Intergenic
1087272462 11:96125381-96125403 GAAGGTGCAGGAGAGGCATGAGG + Intronic
1088359741 11:108977885-108977907 GACAGAGAGTGAGAGACATGTGG + Intergenic
1088737694 11:112741554-112741576 GTCTCTTAATGAGAGACATGAGG + Intergenic
1089638910 11:119834096-119834118 GAGGGTGAATGAGAAGTATGGGG - Intergenic
1089652617 11:119924234-119924256 GACTGTGGATTAGGGGGATGTGG + Intergenic
1090124106 11:124067882-124067904 GACTGTGTATGAAAGGAGTGAGG - Intergenic
1090518259 11:127451594-127451616 GTCTGAGAATGACAGGCAAGGGG + Intergenic
1091296286 11:134476086-134476108 GACTGTGAGTGAGAGGGAAGGGG + Intergenic
1094188918 12:27676939-27676961 CACCGTGGAGGAGAGGCATGCGG - Intronic
1094621505 12:32084797-32084819 GACTGTTAATGACAGCCATTGGG + Intergenic
1094797182 12:33988615-33988637 GACAGTGGGTGAGAGGAATGGGG - Intergenic
1094865155 12:34523096-34523118 GAGTGTGAGAAAGAGGCATGGGG - Intergenic
1095175479 12:39087086-39087108 GACTGTGTATTATAGGGATGGGG + Intergenic
1103865617 12:124049618-124049640 CACAGTGAATAAGATGCATGTGG - Intronic
1104529786 12:129558587-129558609 GTCTGCCAATGAGAGGCATGAGG - Intronic
1105994128 13:25654030-25654052 CACTGTGAAGGTAAGGCATGAGG + Intronic
1106171711 13:27294381-27294403 GACTGAGGGTGAGAGGCAGGAGG - Intergenic
1109825093 13:67708693-67708715 GACAGTGAAAGTGAGGTATGAGG + Intergenic
1110654901 13:77986480-77986502 GACGGTGCATGAGAGTCCTGGGG + Intergenic
1110937360 13:81307645-81307667 GAATTTGACTGAGGGGCATGAGG - Intergenic
1111814030 13:93128167-93128189 GAATGAGAATGAGAGGCAGAAGG - Intergenic
1112817502 13:103290341-103290363 GACTGTGACTGGGAGGGAGGAGG + Intergenic
1112933810 13:104774612-104774634 GACTGGAACTGAGAGTCATGGGG + Intergenic
1114704161 14:24708642-24708664 GACTTAGAAGGAGAGGCCTGAGG + Intergenic
1114727603 14:24955329-24955351 GAATGTGGATGAGTGGCCTGTGG - Intronic
1117141200 14:52792075-52792097 AACTGTGACTCAGAGGCCTGGGG - Intergenic
1117833502 14:59778196-59778218 AACTGTGATTGAAAGCCATGTGG - Intronic
1117847323 14:59924957-59924979 GAGTGTGAGTGTGAGCCATGCGG - Intronic
1118015043 14:61651893-61651915 GACAGTGATTGAGAGGGAGGAGG + Intronic
1118342248 14:64904480-64904502 GACTGTGAAAGGTGGGCATGAGG + Intergenic
1118981799 14:70723114-70723136 AACTGTGTATCAAAGGCATGTGG + Intronic
1119611700 14:76068835-76068857 GAGTGTGATTGTGATGCATGGGG + Intronic
1120514016 14:85448895-85448917 GGATGTAAATGAGAGGAATGAGG + Intergenic
1121522386 14:94594899-94594921 GGCTGTGAATGAGGGTCCTGAGG - Intronic
1122679302 14:103445289-103445311 GACTGTGAATGTGAAGCATCTGG + Intronic
1123874947 15:24614678-24614700 TCCAGTGAAGGAGAGGCATGTGG - Intergenic
1125114658 15:36076023-36076045 GACTGTGACTGAGAGTCTGGTGG + Intergenic
1125713562 15:41805968-41805990 GAGTGTGAATGAGGGCCCTGGGG - Intronic
1126418624 15:48446792-48446814 GAATGTGAAAGAGATGCCTGTGG - Exonic
1127629873 15:60818076-60818098 TACTGTGAGTGAGAGGGATTAGG + Intronic
1129809429 15:78496052-78496074 GATTGAGATTCAGAGGCATGAGG - Intronic
1130106562 15:80932887-80932909 GACTGTGTGTGAGAGGGAGGTGG - Intronic
1132407636 15:101553731-101553753 GACTGTGGACGAGAGGCACAGGG - Intergenic
1132790184 16:1681798-1681820 GACTGTGAATGTAGGGAATGTGG + Intronic
1133973139 16:10580938-10580960 GAAAGAGAATGAGAGGGATGTGG - Intergenic
1140813389 16:78599547-78599569 GCCTGGAAATGAGAGGAATGTGG - Intronic
1142678711 17:1532702-1532724 GACTGTGTAAGAGAAGCCTGAGG - Intronic
1143012813 17:3875615-3875637 GGCTGTGGGTGAGAGGCATTTGG - Intronic
1143031600 17:3971101-3971123 GACTCTGAATGAGACCCCTGTGG + Intergenic
1144469162 17:15521855-15521877 GTCAGAGAATGAGAGACATGTGG - Intronic
1144927202 17:18821816-18821838 GTCAGAGAATGAGAGACATGTGG + Intergenic
1147547553 17:41414358-41414380 TACAGTCAATGAGACGCATGGGG + Intergenic
1149149621 17:53544903-53544925 TATTGTGAAGGAAAGGCATGGGG - Intergenic
1150145484 17:62765585-62765607 CCCTCTGAAGGAGAGGCATGTGG + Intronic
1150191791 17:63249445-63249467 GGCAGTGAATTAGAGGGATGTGG + Intronic
1150538797 17:66075684-66075706 TATGGTGGATGAGAGGCATGAGG + Intronic
1151637990 17:75365939-75365961 GACTATGAAAGAGAGGAAAGAGG - Intronic
1152469520 17:80483025-80483047 GACTGGGCTTGAGAGGCTTGAGG + Intergenic
1153971573 18:10231893-10231915 GTCTCTGCATGAGAGGCAGGGGG - Intergenic
1157940641 18:51925399-51925421 TACTATAAAGGAGAGGCATGAGG - Intergenic
1157972097 18:52282622-52282644 TACTGTAAATGAGATGCATGCGG + Intergenic
1158257691 18:55571716-55571738 GAATGTGAATGAGAGGTAGAGGG + Intronic
1158728341 18:59995444-59995466 GACAGTGAAGGAGAGACAAGAGG - Intergenic
1159669210 18:71202007-71202029 AACTGAAAATGAGAGGCTTGAGG - Intergenic
1160981094 19:1816989-1817011 GCCTCTGAATGGGAGGCAGGAGG - Intronic
1162288293 19:9757710-9757732 GCCTGTGAATGTAAGGAATGCGG - Exonic
1165104014 19:33458032-33458054 TACCGTGTATGTGAGGCATGTGG + Intronic
1166293794 19:41879192-41879214 GAATGTGAACAAGAGCCATGGGG + Exonic
1166902105 19:46072589-46072611 GAATGTGAAGCAGGGGCATGTGG + Intronic
1167903235 19:52637807-52637829 GACTGTGGAGGAGAGACCTGTGG + Intronic
1167952294 19:53037344-53037366 GACTGCAAACGAGAGGCCTGGGG + Intergenic
1167955092 19:53057999-53058021 GACTGCGAAGGGGAGGCCTGGGG + Intergenic
1167960744 19:53102864-53102886 GACTGCGAAGGGGAGGCCTGGGG + Intronic
1167967306 19:53158214-53158236 GACTGCGAAGGGGAGGCCTGGGG + Intronic
1168531076 19:57129498-57129520 TGCTGTGAATGAGAGTCAAGAGG - Exonic
925162125 2:1692889-1692911 GACTGTGAATGCCAGGACTGTGG - Intronic
926502711 2:13675580-13675602 GAATTTGAGTGAGGGGCATGAGG + Intergenic
927333211 2:21890627-21890649 GCCTGTGCATGACAGGTATGAGG + Intergenic
927652983 2:24923377-24923399 CACTGTGAGTGAGATGGATGAGG - Intergenic
927948944 2:27154590-27154612 GAATGTGGATGGGAGCCATGGGG + Exonic
928020762 2:27703015-27703037 GGCTGTGTATGAGAGGAGTGGGG - Intergenic
929059555 2:37909342-37909364 TGCTGGGAATGAGAGGAATGAGG + Intergenic
929183809 2:39071860-39071882 GAGAATGAATGACAGGCATGGGG - Intronic
930012207 2:46945981-46946003 GACTGTGAATGGGTGGGTTGTGG + Intronic
931146983 2:59529913-59529935 GATTGAGAATGTGAGCCATGTGG + Intergenic
932461391 2:71884061-71884083 GACAGTGAAGAAGAGGCAGGGGG + Intergenic
932820205 2:74893460-74893482 GTGTGTGTTTGAGAGGCATGTGG + Intergenic
935006501 2:99083828-99083850 GACTGTAAAGGAGTAGCATGAGG + Intronic
935228178 2:101072641-101072663 AACTGTGCATGCGAGGCATCTGG - Intronic
936042437 2:109160257-109160279 GAGTGTGACAGACAGGCATGAGG + Intronic
939129080 2:138212662-138212684 GTCTGTGCATGAGGGCCATGAGG + Intergenic
940124328 2:150307822-150307844 GACAGTGAATGGGAGTCATGTGG - Intergenic
941276461 2:163497144-163497166 GCCTATGATTGAAAGGCATGTGG - Intergenic
944553890 2:200869277-200869299 AACTTAGAATGGGAGGCATGCGG - Intergenic
944690646 2:202155632-202155654 GACTGAGAAAGACAGGAATGGGG + Intronic
946366767 2:219253548-219253570 GACTCTGTATGAGAGTCACGCGG - Intronic
947770872 2:232669099-232669121 GGCTGCGGATGAGAGGCATGTGG - Intronic
947859406 2:233348195-233348217 GACTGGGCGTGAGAGGCATAGGG + Intergenic
948797524 2:240412473-240412495 GGGTGTGATTGACAGGCATGAGG + Intergenic
948811143 2:240479031-240479053 CACTGGGAATGAGAGGAAGGAGG - Intergenic
948935914 2:241164535-241164557 GACTGATACTGAGGGGCATGTGG + Intronic
1169390601 20:5187238-5187260 TACTGTGAGTGTGTGGCATGAGG - Intronic
1169755484 20:9038916-9038938 GCCCTTGAATGAGAGGCATATGG + Intergenic
1170212560 20:13860081-13860103 GTCTGAGAATGGGAGGGATGGGG - Intronic
1170343790 20:15359974-15359996 GACTATGAATGGGTAGCATGAGG - Intronic
1170508020 20:17048512-17048534 GACTGAGGTTGAGAGGAATGTGG - Intergenic
1174135896 20:48378996-48379018 CACAGTGAAAGAGAGGCATGGGG - Intergenic
1174844936 20:53935182-53935204 GACTGTGAAGTAGAGACAAGGGG + Intergenic
1175661890 20:60820569-60820591 GACAGTGAATAAGTGTCATGAGG + Intergenic
1175883527 20:62274349-62274371 AGCTGTGGATGAGAGGGATGTGG + Intronic
1176953098 21:15068216-15068238 AAATGTGAATGAGAGGGATATGG - Intergenic
1177325127 21:19576204-19576226 GTGTGTGGATGAGAGACATGCGG - Intergenic
1178532990 21:33390653-33390675 GACAGTGAATGTGAGGCATTCGG + Intergenic
1180137220 21:45869511-45869533 GACTGTGCAGGTGAGGCTTGGGG + Intronic
1181842868 22:25679730-25679752 GACAGAGAGGGAGAGGCATGGGG + Intronic
1181978619 22:26750644-26750666 GTCTGTGGATGAGAAGGATGTGG - Intergenic
1182459454 22:30473378-30473400 GACTGTGAAGGAGAGCCAGGAGG + Intergenic
1183954217 22:41369442-41369464 CACTGAGAGTGAGAAGCATGAGG + Intronic
1184550257 22:45200575-45200597 TGCTGGGAATGAGAGGGATGGGG - Intronic
949330851 3:2920323-2920345 GACTGTGAAGGGGAAGCAAGAGG + Intronic
949588361 3:5466083-5466105 GAGCGTGAATGGGAGGCAGGGGG - Intergenic
949597210 3:5560592-5560614 GACTGTGAATGACAGGGACATGG - Intergenic
951116158 3:18864459-18864481 GACTGTTAATGGGAGCTATGTGG + Intergenic
951532724 3:23712845-23712867 AACTGTTAAAGAGAGGGATGAGG + Intergenic
951604142 3:24413485-24413507 GACTGTTATTGAGTGGCATTTGG - Intronic
952114426 3:30161949-30161971 GGATGTGAAGGAGGGGCATGTGG - Intergenic
952325389 3:32315866-32315888 GAGAGGGAATGAGAGGCATCTGG - Intronic
952782694 3:37118544-37118566 GACTGTGAATGGTAGGATTGGGG - Intronic
952902806 3:38121073-38121095 GAGTGTGAAGGAGTGGCCTGGGG + Intronic
953364032 3:42326354-42326376 GAGTAGGAATGAGAGACATGGGG + Intergenic
954218491 3:49137908-49137930 GACTGTGGGTGGGAGCCATGGGG - Intergenic
954427171 3:50449529-50449551 GACTGTGGATTTTAGGCATGGGG + Intronic
954543039 3:51408593-51408615 CACTGTGCATGAGAGGCAGTAGG + Intronic
956386845 3:68728666-68728688 AACTTGGAATGGGAGGCATGGGG + Intergenic
957130971 3:76222253-76222275 GAATCTGACTGAGAGGCATAAGG + Intronic
959502710 3:107124931-107124953 AACTTGGAATGGGAGGCATGAGG + Intergenic
961052572 3:123759431-123759453 AAGTATTAATGAGAGGCATGTGG + Intronic
962041101 3:131708192-131708214 GAGAGTGAATGAGAGCCATGAGG + Intronic
962665232 3:137647603-137647625 GCCTGTGAATGAGAGACAAAGGG - Intergenic
963172281 3:142263134-142263156 GAAAGAGAATGAGAGACATGGGG + Intergenic
964600327 3:158493435-158493457 AACTCTAAATGAGAGGTATGAGG - Intronic
967094943 3:186169969-186169991 GACAGTGAAAGAGAGGGTTGGGG + Intronic
967931110 3:194690899-194690921 ATCTGTGACTGACAGGCATGTGG + Intergenic
968582274 4:1400692-1400714 GACTGTGAATCAGAGACTGGAGG + Intergenic
968868136 4:3227019-3227041 GGCTGAGAGTGAGAGGCCTGGGG + Intronic
970437049 4:16045857-16045879 GACCATGAATGAGAAGCAGGCGG - Intronic
971291094 4:25340363-25340385 GACTGTGTAAGAGTGGCATAGGG - Intronic
971461028 4:26896848-26896870 GACTATGAAGGGGAAGCATGAGG - Intronic
972833842 4:42844575-42844597 GACTGAGAGTGGGAGGCATGGGG + Intergenic
975294959 4:72723726-72723748 GACAGTCAATTAGAGGAATGAGG + Intergenic
978382790 4:108147627-108147649 GACTGTGAATTGCAGGCTTGAGG - Intronic
979005995 4:115297868-115297890 GACTGTAAATGACAAGCAAGAGG + Intergenic
979090475 4:116477379-116477401 GTGTCTGAATGAGAGGGATGTGG + Intergenic
980777465 4:137454845-137454867 AACTTGGAATGGGAGGCATGTGG + Intergenic
982199019 4:152942067-152942089 GACTGTGTATAAGGGACATGTGG + Intronic
983408066 4:167356966-167356988 AACTGTGAAAGAGAAGCAAGTGG - Intergenic
983611313 4:169648290-169648312 AACTATGAATGAGAGGTATTTGG + Intronic
985558245 5:568655-568677 GGCTGTGAATGTGGGGCAAGGGG - Intergenic
986227538 5:5829459-5829481 GACTGTGGCTGAGTGCCATGGGG - Intergenic
986751640 5:10792985-10793007 GAATTTGACTGAGAGGCATAAGG - Intergenic
988896738 5:35682848-35682870 GAATGAGAATGAGATGCATGTGG + Intronic
988964481 5:36402664-36402686 GACTGTGAAGAAGAGGCTTTGGG - Intergenic
991657620 5:68919900-68919922 GAATTTGACTGAGAGGCATAAGG + Intergenic
993243727 5:85424966-85424988 GTCTTTGAAAGAGAGGAATGGGG + Intergenic
994985359 5:106926534-106926556 GACTGGGACTGAGAGACAGGAGG - Intergenic
995875982 5:116790411-116790433 GACTGTGAACAAGAGGAATTAGG + Intergenic
995924033 5:117347646-117347668 GACAGTGTGTGAGAGGCCTGAGG - Intergenic
997657145 5:135563909-135563931 GACTTTGAAGGAGAGGGTTGAGG + Intergenic
997753620 5:136373757-136373779 GAAAGTGAAGTAGAGGCATGTGG + Intronic
999409267 5:151336172-151336194 GACTGTAAATCACAGTCATGTGG + Intronic
1000169309 5:158686386-158686408 CACTGTGAATGGAAGCCATGTGG - Intergenic
1000764082 5:165263961-165263983 GACTCTAAATGAAAGGTATGGGG + Intergenic
1002131407 5:177084288-177084310 GAAGGTGAATGAAAGCCATGTGG + Intergenic
1003212821 6:4082390-4082412 GACTGGGACTGAGAGACAGGAGG - Intronic
1003809779 6:9767127-9767149 GTCTGTGACTGAGAAGCATCAGG - Intronic
1007910819 6:45512498-45512520 GACTCTCTATTAGAGGCATGTGG + Intronic
1009288916 6:61859942-61859964 GCCTGAGAATGAGAGGAATATGG + Intronic
1012622110 6:101358082-101358104 TACTGTGAATTTGAGGCATAAGG - Intergenic
1013320582 6:108984059-108984081 AACTGTGCATGTGAGGGATGTGG + Intergenic
1013370880 6:109470131-109470153 GACAGGGCCTGAGAGGCATGGGG + Intronic
1014757281 6:125315413-125315435 GATTCTGAAAGAGGGGCATGTGG - Intergenic
1016126707 6:140412397-140412419 GACTTTGATTGAGGGGCATAAGG - Intergenic
1016257221 6:142122012-142122034 AACTGGGAATGAGAGGCATGTGG - Intergenic
1016865103 6:148758622-148758644 GACTGTCAATGAGAGGGAAGTGG - Intronic
1017232348 6:152086657-152086679 GTCACTGAATCAGAGGCATGTGG + Intronic
1017607804 6:156151990-156152012 GATTCTGAAGGTGAGGCATGAGG - Intergenic
1018134901 6:160769616-160769638 GAATTTGACTGAGGGGCATGAGG - Intergenic
1018162917 6:161065032-161065054 CACTGTCCATGAGAGGTATGAGG + Intronic
1019392888 7:799337-799359 AACTGTGCATGAGAGGGATTAGG + Intergenic
1021174330 7:17433534-17433556 GATTGTCAATGATGGGCATGTGG + Intergenic
1022417368 7:30189785-30189807 GAGTGTGACTGAGAGACAGGAGG - Intergenic
1023918596 7:44609033-44609055 GACTGGGAATGGGAGGAATGTGG - Intronic
1024841782 7:53595341-53595363 GAGTCTGAATGAGAAACATGGGG - Intergenic
1026621176 7:71951068-71951090 GGCCGTGAATGAGAGAGATGGGG - Intronic
1029548191 7:101222357-101222379 GACTGGGATTGAGAGGAAGGCGG + Intronic
1030515554 7:110533799-110533821 GAATTTGACTGAGAGGCATAAGG - Intergenic
1034357043 7:150459293-150459315 GATGTTGATTGAGAGGCATGAGG + Intronic
1034358405 7:150472487-150472509 TACTGTGGATGAGAGACAGGAGG + Intronic
1035543435 8:459695-459717 GAGTGTGTCTGAGAGGTATGTGG + Intronic
1036479179 8:9122884-9122906 GAGTCTGAATGAAAGGCATACGG - Intergenic
1036688320 8:10926025-10926047 GACAGTCAAGGACAGGCATGTGG - Intronic
1037617563 8:20533369-20533391 GACTGTGAGTGTCAGGGATGAGG + Intergenic
1037639616 8:20730792-20730814 AAGTGTGATTGAGAGGCTTGGGG - Intergenic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038844230 8:31213922-31213944 GACTCTGAAAGGGAGGCATTAGG + Intergenic
1039039077 8:33389892-33389914 GGCTATGAATAAGAAGCATGTGG + Intronic
1039119277 8:34127903-34127925 AACAGAGAAGGAGAGGCATGAGG + Intergenic
1039328302 8:36509219-36509241 GAATGGGACTGAGAGGCAGGAGG - Intergenic
1039822401 8:41145696-41145718 GACTGTGAAAGAGAAGCTTCTGG - Intergenic
1041371467 8:57165143-57165165 GGCTGTGGATCAGAGGCAGGAGG - Intergenic
1041377276 8:57217054-57217076 GAGTTTGACTGAGGGGCATGAGG + Intergenic
1042567533 8:70127610-70127632 TGCTGTCAGTGAGAGGCATGAGG + Intronic
1042647541 8:71004251-71004273 GGCTGGGAATGACAGGCAGGTGG + Intergenic
1043803681 8:84643814-84643836 AACTTGGAATGGGAGGCATGTGG + Intronic
1044031687 8:87246297-87246319 GACTGGGAATGAGAAGCTTTTGG + Intronic
1044249740 8:89991675-89991697 GTGGGTGAATGAGAAGCATGTGG + Intronic
1044488524 8:92783357-92783379 GTAGGTGAAGGAGAGGCATGAGG + Intergenic
1045942178 8:107751853-107751875 GAGTGTGAATGAGACTTATGGGG + Intergenic
1047256741 8:123219164-123219186 GACTGTGATTAAAAGTCATGTGG + Intergenic
1048255726 8:132903726-132903748 GACTGTGATGGAGAGGCAGGCGG + Intronic
1048419472 8:134262520-134262542 GACAGTGAATGAGTCTCATGAGG + Intergenic
1049520451 8:143086011-143086033 GACTGAGAATGAGATGGAAGGGG + Intergenic
1049540916 8:143208377-143208399 GCCTGCGAATGAGAGGCCTGGGG - Intergenic
1050259745 9:3828781-3828803 GACAGAGAGGGAGAGGCATGTGG + Intronic
1050663328 9:7907824-7907846 GAGTGTGAATGGGAGGTAGGCGG + Intergenic
1052521442 9:29553081-29553103 GACTGTGTAGGTGAGGTATGAGG - Intergenic
1053117256 9:35516298-35516320 AAATATGGATGAGAGGCATGGGG - Intronic
1054784788 9:69200324-69200346 AACTGAGGATGAGAGGCCTGGGG - Intronic
1055800599 9:80032035-80032057 GACAGAGAATGAGAGGGGTGAGG + Intergenic
1056173620 9:84012793-84012815 GACTGGGGAGCAGAGGCATGGGG + Intergenic
1056910606 9:90696771-90696793 GACTGTGAAGGAAAGGGCTGGGG - Intergenic
1057134502 9:92677926-92677948 GAGTGTAAAAGAGAGGCAGGTGG - Intergenic
1058766202 9:108185018-108185040 GGCTGTTCAAGAGAGGCATGTGG + Intergenic
1058962871 9:110008207-110008229 GAATGAGAATGAGAGACAGGAGG + Intronic
1059224109 9:112655696-112655718 AACTTGGAATGGGAGGCATGCGG + Intronic
1060415507 9:123426902-123426924 GGCTGTGTCTGAGATGCATGGGG - Intronic
1062200535 9:135300553-135300575 GACCCTGAATGAAAGGCATGTGG + Intergenic
1062626870 9:137447241-137447263 GACTGTGTGGGACAGGCATGCGG + Intergenic
1185503225 X:614633-614655 GAATGGGACTGAGAGGCAGGAGG - Intergenic
1186768363 X:12792985-12793007 CATTGTGAATGAGTGGCAGGTGG + Intronic
1187297117 X:18012590-18012612 GACCTTGATTGAGAGGCTTGAGG - Intergenic
1188210456 X:27418211-27418233 GACTGGGAGTGAGAAGAATGGGG + Intergenic
1190088860 X:47420123-47420145 TACTGTGATTGAGAAACATGAGG - Intergenic
1190916667 X:54816305-54816327 CACTTTGAAGGAGAGGCTTGAGG + Intergenic
1190982691 X:55470541-55470563 GACAGTGATTGAGAGACTTGAGG - Intergenic
1190986008 X:55502642-55502664 GACAGTGATTGAGAGACTTGAGG + Intergenic
1193555905 X:82953201-82953223 GACGGTGAATGTCAGGGATGTGG - Intergenic
1193735811 X:85154806-85154828 GTCTCTGAATGAGAGGTATGAGG + Intergenic
1194234175 X:91361663-91361685 GAATATGAATGAGGGGCATAAGG + Intergenic
1195348550 X:103975787-103975809 GACTGTGACATAGAGCCATGTGG + Intergenic
1195358892 X:104063053-104063075 GACTGTGACATAGAGCCATGTGG - Intergenic
1196187529 X:112760713-112760735 GACTGTGTATCAGAGTAATGTGG + Intergenic
1196292233 X:113956347-113956369 GACAGTGAAAAACAGGCATGAGG - Intergenic
1197234276 X:124041658-124041680 GACTGAGAAAGAGAGAGATGGGG - Intronic
1198012691 X:132574851-132574873 GACTGTGGATGGTAGGCTTGAGG - Intergenic
1200182320 X:154158254-154158276 CACTGTGGATGAGTGTCATGGGG + Intronic
1200187974 X:154195368-154195390 CACTGTGGATGAGTGTCATGGGG + Intergenic
1200193624 X:154232508-154232530 CACTGTGGATGAGTGTCATGGGG + Intronic
1200199379 X:154270312-154270334 CACTGTGGATGAGTGTCATGGGG + Intronic
1201910023 Y:19124521-19124543 GAATTTGACTGAGAGGCATAAGG + Intergenic