ID: 1072255948

View in Genome Browser
Species Human (GRCh38)
Location 10:93620453-93620475
Sequence CATTCTATGCAGTCATAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 417}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072255943_1072255948 20 Left 1072255943 10:93620410-93620432 CCATAGCTCAGGTTGGCAGCGCT 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1072255948 10:93620453-93620475 CATTCTATGCAGTCATAGGATGG 0: 1
1: 0
2: 2
3: 19
4: 417
1072255941_1072255948 30 Left 1072255941 10:93620400-93620422 CCTAAATAGGCCATAGCTCAGGT 0: 1
1: 0
2: 0
3: 9
4: 82
Right 1072255948 10:93620453-93620475 CATTCTATGCAGTCATAGGATGG 0: 1
1: 0
2: 2
3: 19
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072255948 Original CRISPR CATTCTATGCAGTCATAGGA TGG Intronic
900914998 1:5630880-5630902 GATTCTATGCAGCCATAAAAAGG - Intergenic
904843853 1:33393215-33393237 CATTCTTTGCCTTCCTAGGAAGG - Intronic
906391605 1:45422101-45422123 AATACTATGCAGTCATAAAAAGG + Intronic
908058272 1:60316777-60316799 AATACTATGCAGACATAAGAAGG + Intergenic
908910379 1:69066020-69066042 AATTCTATGCAGCCATAAAAAGG - Intergenic
909068749 1:70966784-70966806 AATACTATGCAGTCATAAAAGGG - Intronic
909128793 1:71708926-71708948 AATACTATGCAGCCATAGAAAGG - Intronic
909541522 1:76797143-76797165 CATACTATGCAGCCATAAAAAGG + Intergenic
910441725 1:87260032-87260054 AATACTCTGCAGTCACAGGAGGG + Intergenic
910452523 1:87361562-87361584 AATTCTATGCAGCCATAAAAAGG + Intergenic
910618270 1:89224464-89224486 AATACTATGCAGTCATAAAAAGG - Intergenic
913461393 1:119089781-119089803 AATTCTATGCAGCCATAGAAAGG + Intronic
914405124 1:147363009-147363031 AATACTATGCAGCCATAGAAAGG + Intergenic
914978936 1:152395173-152395195 AATATTATGCAGTCATAAGATGG + Intergenic
915668401 1:157465824-157465846 AATTTTATGCAGACATATGATGG - Intergenic
916754822 1:167759452-167759474 TATTCTATGCAGTCCAAGCAAGG - Intronic
916829869 1:168480157-168480179 AATGCTATGCAGTCATAAAAAGG + Intergenic
918169317 1:181981175-181981197 AATACTATGCAGCCATAGAAAGG + Intergenic
918522452 1:185429851-185429873 CATACTATGCAGCCATAAAAAGG + Intergenic
918834625 1:189445511-189445533 AATACTATGCAGTCATAAAAAGG - Intergenic
918885758 1:190191590-190191612 AATACTATGCAGTCATAAAAAGG - Intronic
918943730 1:191033426-191033448 AATTCTATGCAGCCATAAAAAGG + Intergenic
919041511 1:192394383-192394405 AATACTATGCAGCCATAGAAAGG - Intergenic
919213093 1:194513481-194513503 CATTTTGAGCAGTCATTGGATGG - Intergenic
920828736 1:209446774-209446796 AATACTATGCAGTCATAAAAGGG + Intergenic
921774141 1:219077984-219078006 AATACTATGCAGTCATAAAAAGG + Intergenic
923990687 1:239433794-239433816 AATACTACTCAGTCATAGGAAGG - Intronic
1064342125 10:14496839-14496861 AATACTATGCAGCCATAGAAAGG + Intergenic
1065258695 10:23902175-23902197 AATACTATGCAGTCATAAAAAGG + Intronic
1065438971 10:25729706-25729728 AATACTATGCAGCCATAGAAAGG + Intergenic
1066153355 10:32648963-32648985 AATACTATGCAGTCATAAAAAGG + Intronic
1066751767 10:38664982-38665004 AATACTATGCAGCCATAAGAAGG + Intergenic
1067562878 10:47316126-47316148 CATTTTATGAAGTCATAGAGAGG - Intergenic
1067923791 10:50486963-50486985 AATACTATGCAGTCATAGAAAGG + Intronic
1068114237 10:52719513-52719535 AATACTATGCAGTCATAAAAAGG + Intergenic
1068391797 10:56407742-56407764 AATACTATGCAGTCATAAAAAGG - Intergenic
1068797446 10:61099312-61099334 ATTTCTATGAAGTTATAGGATGG - Intergenic
1068858149 10:61818647-61818669 AATACTATGCAGACATAAGAAGG + Intergenic
1069404621 10:68085728-68085750 CATTCTAGGCATTCAAAGCACGG - Intergenic
1071908467 10:90202518-90202540 AATACTATGCAGCCATAGGAAGG + Intergenic
1072255948 10:93620453-93620475 CATTCTATGCAGTCATAGGATGG + Intronic
1072879796 10:99215270-99215292 AATACTATGCAGTCATAAAAAGG + Intronic
1074595862 10:114866301-114866323 AATACTATGCAGTCATAAAAAGG - Intronic
1075251108 10:120874742-120874764 AATACTATGCAGTCATAAAAAGG - Intronic
1075529005 10:123211162-123211184 AATTCTGTGCAGCCATAGAAAGG - Intergenic
1076254172 10:129007296-129007318 AATACTATGCAGCCATAAGAAGG - Intergenic
1076396803 10:130144643-130144665 AATACTATGCAGTCATAAAAAGG - Intronic
1078513677 11:12006111-12006133 CATTTTAGGCAGTCAGCGGATGG + Intronic
1079234771 11:18680371-18680393 CATTGAAAGCAGTCATAGGCCGG - Intergenic
1079258175 11:18851328-18851350 CATTCTATTCAATAATAGAAAGG + Intergenic
1079396871 11:20071296-20071318 AATTCTATGCAGCCATAAAAAGG - Intronic
1079605452 11:22360132-22360154 CATACTATGCAGTCATAAAAAGG + Intronic
1079665698 11:23102900-23102922 AATACTATGCAGTCATAAAAAGG + Intergenic
1081194773 11:40148055-40148077 AATACTATGCAGCCATAGTATGG - Intronic
1081933908 11:46891535-46891557 AATTCTATGCAATCAATGGAGGG - Intronic
1082674185 11:56075295-56075317 AATACTATGCAGCCATAGAAAGG - Intergenic
1083350313 11:62023564-62023586 AATACTATGCAGCCATAGAAAGG + Intergenic
1085135523 11:74084099-74084121 AATACTATGCAGCCATAGAAAGG + Intronic
1085988746 11:81814082-81814104 AATTCTATGCAGCCATAAAAAGG + Intergenic
1086537214 11:87862315-87862337 AATACTATGCAGTCATAAAAAGG + Intergenic
1086792540 11:91060718-91060740 AATACTATGCAGTCATAAAAAGG + Intergenic
1086831714 11:91574221-91574243 CATTCTATGCGGTTATACCATGG + Intergenic
1088238777 11:107752564-107752586 CATACTACGCAGCCATAAGAAGG - Intergenic
1088501451 11:110487309-110487331 AATACTATGCAGCCATAAGAAGG - Intergenic
1090104312 11:123835667-123835689 AATACTATGCAGCCATAAGAAGG + Intergenic
1091620817 12:2087346-2087368 CATACTCTGTACTCATAGGAAGG - Intronic
1092075329 12:5667888-5667910 AATACTATGCAGCCATAGAAAGG - Intronic
1093241670 12:16684476-16684498 CATTCTCTTCAGTGGTAGGAAGG + Intergenic
1094055208 12:26262268-26262290 CATACTATGCAGCCATAAAAAGG + Intronic
1095117786 12:38376445-38376467 AATAATATGCAGTCATAAGAAGG - Intergenic
1095323462 12:40858783-40858805 AATACTATGCAGCCATAAGAAGG + Intronic
1095556179 12:43507796-43507818 AATTCTATGCAGCCATAAAAAGG + Intronic
1095885084 12:47180277-47180299 AATACTATGCAGTCATAAAAAGG - Intronic
1098431527 12:70424844-70424866 CTTCCTATGCAATCACAGGAAGG - Intronic
1098481735 12:70969658-70969680 AATACTATGCAGTCATAAAAAGG - Intergenic
1099307588 12:80977094-80977116 AATACTATGCAGCCATAGAAAGG - Intronic
1099516930 12:83608503-83608525 AATACTATGCAGTCATAAAAAGG + Intergenic
1099843498 12:87997746-87997768 AATACTATGCAGTCATAAAAAGG - Intronic
1100077220 12:90800481-90800503 AATACTATGCAGCCATAAGAAGG + Intergenic
1100274579 12:93060448-93060470 CCTTATATGAGGTCATAGGAGGG + Intergenic
1101625639 12:106438223-106438245 AATACTATGCAGTCATAAAAAGG - Intronic
1102659599 12:114514325-114514347 AATTCTCTGCAGTCATGGCAGGG + Intergenic
1103179237 12:118894315-118894337 AATACTATGCAGTCATAAAAAGG + Intergenic
1104042072 12:125137022-125137044 CTTTAAATGCAGTCTTAGGAAGG - Intronic
1104577188 12:129978281-129978303 AATACTATCCAGTCATAGAAAGG - Intergenic
1105574155 13:21634577-21634599 CATTATATGCATTTATATGAAGG + Intergenic
1105732172 13:23228805-23228827 AATACTATGCAGCCATAAGAAGG - Intronic
1106504095 13:30356192-30356214 CCTTCTATGCAGCCATAGGGAGG + Intergenic
1106921238 13:34565765-34565787 AATACTATGCAGTCATAAAAAGG + Intergenic
1107084886 13:36416234-36416256 AATACTATGCAGTCATAAAAAGG + Intergenic
1108136344 13:47366545-47366567 AATACTATGCAGCCATAGAAAGG - Intergenic
1108982593 13:56537517-56537539 AATACTATGCAGCCATAGAAAGG - Intergenic
1109446193 13:62444095-62444117 TATACTATGTAGTCTTAGGAAGG + Intergenic
1109799134 13:67351934-67351956 CATTCTATGAAATCAGTGGATGG + Intergenic
1110411783 13:75212298-75212320 CATACTATGCAGCCATAAAAAGG + Intergenic
1110517474 13:76431950-76431972 AATACTATGCAGCCATAGAAAGG + Intergenic
1111140244 13:84108157-84108179 CATTCTAAGCAGTCGTTGGAAGG + Intergenic
1111142802 13:84143357-84143379 AATACTATGCAGCCATAAGAAGG - Intergenic
1111234864 13:85396690-85396712 AATACTATGCAGCCATAGAAAGG - Intergenic
1111415621 13:87939995-87940017 AATACTATGCAGTCATAAAAAGG + Intergenic
1111907902 13:94276774-94276796 AATACTATGCAGTCATAAAAAGG - Intronic
1111950205 13:94703755-94703777 CAGTCTATGCAGGCAGAGTAAGG + Intergenic
1114893894 14:26961458-26961480 AATTCAATGCAGTGAAAGGAAGG - Intergenic
1115016786 14:28625672-28625694 AATACTATGCAGTCATAAAAAGG - Intergenic
1115981009 14:39051650-39051672 AATACTATGCAGCCATAAGAAGG + Intronic
1116506734 14:45692080-45692102 AATACTATGCAGTCATAAAAAGG + Intergenic
1117472965 14:56065176-56065198 AATACTATGCAGTCATAGGAAGG + Intergenic
1117845665 14:59908784-59908806 AATTCTATGCAGCCATAAAAAGG - Intergenic
1120124745 14:80728157-80728179 AATACTATGCAGCCATAAGAAGG + Intronic
1120162727 14:81162901-81162923 GATTCTCTGAAGTCATAGGTAGG + Intergenic
1120320726 14:82957037-82957059 AATACTATGCAGTCATAAAAAGG - Intergenic
1120760444 14:88280100-88280122 GATTTTATGCAGTTTTAGGATGG - Intronic
1202847200 14_GL000009v2_random:190002-190024 TATTCTATGCACACATAGGAAGG - Intergenic
1202916663 14_GL000194v1_random:180564-180586 TATTCTGTGCACACATAGGAAGG - Intergenic
1202876114 14_KI270722v1_random:2498-2520 TATTCTGTGCACACATAGGAAGG + Intergenic
1123586832 15:21768639-21768661 AATACTATGCAGCCATAGAAAGG + Intergenic
1123623471 15:22211204-22211226 AATACTATGCAGCCATAGAAAGG + Intergenic
1123670076 15:22647694-22647716 AATACTATGCAGTCATAGAAAGG + Intergenic
1124526050 15:30454110-30454132 AATACTATGCGGTCATAGAAAGG + Intergenic
1124772604 15:32553575-32553597 AATACTATGCGGTCATAGAAAGG - Intergenic
1125285432 15:38087822-38087844 CATGGTAGGCAGTCATGGGAGGG - Intergenic
1126673778 15:51139797-51139819 AATACTATGCAGCCATAGAAAGG - Intergenic
1127672191 15:61205856-61205878 CATTTAATGCAGTCAGGGGAAGG + Intronic
1128983785 15:72204778-72204800 CATTCTATGCAGTGATTTCATGG + Intronic
1129174820 15:73832409-73832431 CTGTCTGTGAAGTCATAGGAGGG + Intergenic
1130196359 15:81783549-81783571 CTTTCTCAGCAGTCATAGGGCGG - Intergenic
1131966601 15:97850658-97850680 AATACTATGCAGTCATAAAAAGG - Intergenic
1133563825 16:6974112-6974134 AATTCTATGCAGCCATAAAAAGG - Intronic
1135670177 16:24368696-24368718 CAGCCAATCCAGTCATAGGATGG + Intergenic
1137439769 16:48488402-48488424 CATTCAATGTGGCCATAGGATGG - Intergenic
1137464522 16:48696202-48696224 AATACTATGCAGCCATAGAAAGG - Intergenic
1138258842 16:55598439-55598461 AATACTATGCAGCCATAGGAAGG + Intergenic
1139320000 16:66106678-66106700 CATTCTATGAAGGAATAGGATGG - Intergenic
1140319543 16:73935775-73935797 AATGCTATGCAGTCATAACAAGG + Intergenic
1140689223 16:77465547-77465569 CATATTATTCAGTCATAAGAAGG + Intergenic
1143033412 17:3980880-3980902 CATTGAATGAAGTCACAGGAGGG - Intergenic
1144501930 17:15795644-15795666 AATACTATGCAGTCATAAAAAGG - Intergenic
1144511952 17:15884755-15884777 AATTCTATGCAGCCATAAAAAGG - Intergenic
1145733153 17:27208872-27208894 AATTCTATGCAGCCATAAAAAGG + Intergenic
1146093642 17:29907167-29907189 AATACTATGCAGTCATAAAAAGG + Intronic
1146528049 17:33583812-33583834 CATTTTATTCAGTCACAGCATGG + Intronic
1146971094 17:37073052-37073074 AATACTATGCAGCCATAAGAAGG + Intergenic
1146999728 17:37352898-37352920 CATCCTATGCAGTTTTAGGGAGG + Intronic
1149417032 17:56470123-56470145 AATACTATGCAGCCATAAGAAGG - Intronic
1150939121 17:69670959-69670981 AATACTATGCAGTCATAAAAAGG - Intergenic
1151437368 17:74106173-74106195 AATACTATGCAGTCATAAAAAGG + Intergenic
1153273631 18:3347542-3347564 CATTCTCTGCAGTCACTTGAGGG + Intergenic
1153812189 18:8762016-8762038 AATTCTATTCAGACATAGAAAGG - Intronic
1155432700 18:25777589-25777611 AATACTATGCAGCCATAGAAAGG + Intergenic
1156095556 18:33527216-33527238 AATACTATGCAGTCATAAAAAGG - Intergenic
1156437497 18:37148312-37148334 AATACTATGCAGTCATAAAAAGG - Intronic
1157962910 18:52176809-52176831 TATTCTATCAAGACATAGGAAGG - Intergenic
1158858419 18:61567667-61567689 AATACTATGCAGTCATAAAAAGG - Intergenic
1160177744 18:76609717-76609739 AATGCTATGCAGCCATAGAAAGG - Intergenic
1160210895 18:76878021-76878043 CATTCTGTACAGTTATAGGTAGG - Exonic
1160632999 18:80259409-80259431 CATGCTATTTAGTCATAGAAAGG - Intergenic
1164771111 19:30809781-30809803 AATACTATGCAGTCATAAAAAGG - Intergenic
1165289519 19:34872101-34872123 AATACTATGCAGCCATAGAAAGG + Intergenic
1167840503 19:52113797-52113819 GATACTATGCAGCCATAGAAAGG - Exonic
1168437348 19:56330169-56330191 AATACTATGCAGTCATAAAACGG - Intronic
1168491422 19:56813913-56813935 CATTCATGGCAGTCATAGTATGG + Exonic
1202674548 1_KI270710v1_random:30315-30337 TATTCTGTGCACACATAGGAAGG - Intergenic
925210084 2:2038050-2038072 CATTCCATGCAGACGTAGCATGG + Intronic
925511949 2:4637873-4637895 AATACTATGCAGTCATAAAAAGG + Intergenic
926392770 2:12410809-12410831 AAATCTATGCAGCCATAGAAAGG - Intergenic
926443888 2:12920702-12920724 AATACTATGCAGTCATAAAAAGG - Intergenic
926851686 2:17204920-17204942 AATACTATGCAGTCATAAAAAGG - Intergenic
928403229 2:30994282-30994304 CATTCTACTCAGTAATGGGATGG - Intronic
928685883 2:33748432-33748454 AATTCTATGCAGCCATAAAAAGG + Intergenic
929805005 2:45137179-45137201 AATTCTATGCAGCCATTGAAAGG - Intergenic
930831600 2:55749660-55749682 AATACTATGCAGTCATAAAAAGG + Intergenic
931420866 2:62126106-62126128 AATACTATGCAGTCATAAAAAGG - Intronic
932869152 2:75379672-75379694 CATTCTAATCAGGCAGAGGAGGG + Intergenic
932908347 2:75779019-75779041 AATACTATGCAGCCATAGAAAGG + Intergenic
933237202 2:79878151-79878173 AATACTATGCAGCCATAAGAAGG - Intronic
936805912 2:116332129-116332151 AATGCTATGCAGCCATAGGAAGG - Intergenic
937723580 2:125132236-125132258 AATACTATGCAGTCATAAAAAGG - Intergenic
937932083 2:127214475-127214497 AATGCTATGCAGTCATAAAAAGG + Intronic
938650997 2:133383399-133383421 AATACTATGCAGTCATAAAAAGG - Intronic
939297748 2:140291644-140291666 AATACTATGCAGCCATAGAAAGG - Intronic
939421648 2:141978958-141978980 CATTCTGTTAAGTCATAAGATGG - Intronic
939487141 2:142828568-142828590 AATTCTATGCAGCCATAAAAAGG - Intergenic
939981716 2:148790356-148790378 AATACTATGCAGTCATAAAAAGG - Intergenic
940171894 2:150837703-150837725 AATACTATGCAGCCATAGAAAGG - Intergenic
940571248 2:155437579-155437601 AATACTATGCAGTCATAAAAAGG - Intergenic
940615507 2:156044217-156044239 AATACTATGCAGCCATAGAAAGG - Intergenic
940745643 2:157564761-157564783 GATACTATGCAGCCATAAGAAGG + Intronic
941704186 2:168640470-168640492 CAATCACTGCTGTCATAGGATGG - Intronic
942391122 2:175494055-175494077 AATACTATGCAGTCATAAAAAGG - Intergenic
942581550 2:177424297-177424319 AATACTATGCAGCCATAGAAAGG - Intronic
943428878 2:187772882-187772904 AATACTATGCAGTCATAAAAAGG + Intergenic
943598581 2:189887312-189887334 AATACTATGCAGTCATAAAAAGG - Intronic
945520554 2:210822232-210822254 AATACTATGCAGCCATAAGAAGG + Intergenic
945780178 2:214161137-214161159 AATACTATGCAGCCATAGAAAGG - Intronic
948237298 2:236400635-236400657 CTCTCTATGCAGTGACAGGAGGG + Intronic
1169577420 20:6980622-6980644 AATTCTATGCAGCCATAAAAAGG - Intergenic
1169978620 20:11358583-11358605 AATACTATGCAGCCATAGAAAGG - Intergenic
1170378222 20:15726266-15726288 AATACTATGCAGCCATAGAAAGG - Intronic
1170723923 20:18908794-18908816 CTTTCTATCCAGACAGAGGAAGG - Intergenic
1173121339 20:40292579-40292601 AATACTATGCAGCCATAAGAAGG + Intergenic
1173258845 20:41415308-41415330 CAATCTGTCCAGTCACAGGATGG + Exonic
1173771113 20:45659047-45659069 AATACTATGCAGTCATAAAAAGG - Intronic
1174741899 20:53022603-53022625 CATTATAAGCATTCTTAGGAAGG - Intronic
1175607877 20:60326124-60326146 TATTCTCTGCACTCATAAGAAGG + Intergenic
1176636017 21:9195211-9195233 TATTCTGTGCACACATAGGAAGG - Intergenic
1176889655 21:14299158-14299180 CATACTATGCAGCCATAAAAAGG - Intergenic
1177022516 21:15880718-15880740 AATACTATGCAGTCATAAAAAGG - Intergenic
1177463876 21:21448200-21448222 AATACTATGCAGCCATAGAAAGG + Intronic
1177674573 21:24279858-24279880 AATACTATGCAGTCATAAAAAGG - Intergenic
1178473348 21:32914904-32914926 CATTTTCTGCAGTGATTGGAAGG + Intergenic
1178714557 21:34952033-34952055 AATACTATGCAGTCATAAAAAGG + Intronic
1179963075 21:44781822-44781844 CATTTTATGAAATCATAGTAGGG + Intronic
1180035672 21:45247175-45247197 CATTCCATGGAGTCATCGAATGG + Intergenic
1180410692 22:12604011-12604033 AATACTATGCAGTCATAAAAAGG - Intergenic
1181318230 22:21985006-21985028 CATTGTATGGAGCCCTAGGAAGG + Intergenic
1181656087 22:24300314-24300336 AATACTATGCAGCCATAAGAAGG - Intronic
1182581407 22:31314419-31314441 AATACTATGCAGTCATAAAAAGG + Intergenic
949466481 3:4349640-4349662 AATACTATGCAGTCATAAAAAGG + Intronic
949804784 3:7942937-7942959 AATTCTATGCAGCCATAAGAAGG + Intergenic
949868586 3:8567814-8567836 TATTCTAAGAAGTCTTAGGATGG + Exonic
951189873 3:19755596-19755618 AATACTATGCAGCCATAAGAAGG - Intergenic
951531178 3:23699533-23699555 CAGTCTCTGCAGCCATAGAAAGG + Intergenic
951607069 3:24447436-24447458 CCTTCTTTGCAGTAATGGGAGGG + Intronic
951608086 3:24459298-24459320 AATACTATGCAGTCATAAAAAGG - Intronic
951722665 3:25717444-25717466 AATACTATGCAGCCATAGAAAGG + Intergenic
951897154 3:27620434-27620456 AATACTATGCAGTCATAAGAAGG - Intergenic
951939839 3:28065554-28065576 CATACTATGCAGCCATAAAAAGG + Intergenic
951971884 3:28454820-28454842 AATACTATGCAGCCATAAGAAGG - Intronic
953079658 3:39603933-39603955 AATACTATGCAGTCATAAAAAGG - Intergenic
955845348 3:63156832-63156854 AATACTATGCAGCCATAGAAAGG + Intergenic
956309902 3:67867261-67867283 AATTCTATGCAGCCATAAAAAGG - Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956395688 3:68823787-68823809 CATACTATGCAGCCATAAAAAGG - Intronic
957103499 3:75857174-75857196 TATTCTGTGCACACATAGGAAGG - Intergenic
957228917 3:77486116-77486138 AATACTATGCAGTCATAAAAAGG - Intronic
958077229 3:88696330-88696352 AATACTATGCAGTCATAAAAAGG + Intergenic
958756117 3:98251190-98251212 AATACTATACAGTCATAGAAAGG + Intergenic
959352891 3:105290134-105290156 AATACTATGCAGCCATAAGAAGG - Intergenic
959931880 3:111993972-111993994 CAATCAATGAAGGCATAGGAAGG + Intergenic
960783373 3:121345343-121345365 AATACTATGCAGTCATAAAAAGG - Intronic
961204435 3:125069625-125069647 CTTTGAATGCAGTCATATGATGG + Intergenic
962002721 3:131315891-131315913 AATACTATGCAGCCATAAGAAGG - Intronic
962822397 3:139063245-139063267 CATGCTTTGCAGTTATTGGATGG + Intronic
963587126 3:147206014-147206036 AATACTATGCAGCCATAGAAAGG - Intergenic
964147766 3:153486207-153486229 CATTCTAGGCAATTTTAGGAAGG - Intronic
964594874 3:158414206-158414228 AATACTATGCAGTCATAAAAAGG + Intronic
964689936 3:159438825-159438847 CATACTATGCAGCCATAAAAAGG - Intronic
964831772 3:160891803-160891825 AATACTATGCAGTCATAAAAAGG + Intronic
965078320 3:164005390-164005412 CATACTATGCAGCCATAAAAAGG + Intergenic
965353606 3:167646268-167646290 CATTCTTTACAGTCCTAGGAAGG + Intronic
965794036 3:172419706-172419728 AATTCTATGCAGCCATAAAAAGG - Intergenic
966203883 3:177386236-177386258 CATTTTATGCAGTCACATGATGG - Intergenic
967396056 3:189010129-189010151 AATTCTATGCAGCCATAAAAAGG - Intronic
968695960 4:2026855-2026877 AATACTATGCAGTCATAAAAAGG - Intronic
969763190 4:9206156-9206178 AATACTATGCAGTCATAAAAAGG + Intergenic
970286833 4:14527229-14527251 AATACTATGCAGCCATAAGAAGG + Intergenic
970687121 4:18581073-18581095 AATACTATGCAGTCATAAAAAGG - Intergenic
970836108 4:20409406-20409428 AATACTATGCAGTCATAAAAGGG - Intronic
970888689 4:21017006-21017028 CATTTTATGAACTCATAGAAGGG + Intronic
971762301 4:30781974-30781996 CATTCTATCCAATCAAAGAAAGG - Intronic
971791362 4:31173819-31173841 AATACTATGCAGCCATAGAAAGG - Intergenic
972238298 4:37160170-37160192 CATTTCTTGCAGGCATAGGAAGG + Intergenic
972861369 4:43173047-43173069 AATACTATGCAGTCATAAAAAGG + Intergenic
973164776 4:47063695-47063717 CATACTATGCAGCCATAAAAAGG + Intronic
974316458 4:60288109-60288131 AATGCTATGCAGCCATAGAAAGG + Intergenic
974673361 4:65058985-65059007 CTTTGTATGCAGTCCAAGGAAGG + Intergenic
974769168 4:66388380-66388402 AATACTATGCAGTCATAAAAAGG + Intergenic
976035746 4:80818187-80818209 AATACTATGCAGTCATAAAATGG - Intronic
976142938 4:82011910-82011932 AATACTATGCAGCCATAGAAAGG + Intronic
976527365 4:86109570-86109592 AATACTATGCAGTCATAAAAAGG - Intronic
977186548 4:93945486-93945508 AATACTATGCAGTCATAAAAAGG + Intergenic
977508501 4:97932701-97932723 AATACTATGCAGTCATAAAAAGG - Intronic
977619680 4:99122002-99122024 GATACTATGCAGTCATAAAAAGG - Intergenic
977679174 4:99780083-99780105 AATACTATGCAGTCATAAAAAGG + Intergenic
977850115 4:101817334-101817356 AATTCTATGCAGCCATAAAAAGG + Intronic
978240940 4:106515481-106515503 AATACTATGCAGCCATAAGAGGG - Intergenic
979068019 4:116164131-116164153 AATTCTATGCAGTCATAAAAAGG - Intergenic
979152471 4:117337408-117337430 CATACTATGCAGCCATAAAAAGG - Intergenic
979791894 4:124794242-124794264 AATTCTATGCAGCCATAAAAAGG + Intergenic
980333045 4:131434501-131434523 AATACTATGCAGTCATAAAAAGG - Intergenic
981634459 4:146860534-146860556 CTTCCTATACAGTCATAGGCAGG + Intronic
981742799 4:148020631-148020653 AATACTATGCAGTCATAAAAAGG - Intronic
982679633 4:158413389-158413411 AATACTATGCAGTCATAAAAAGG - Intronic
982776955 4:159451838-159451860 AATACTATGCAGTCACAGAAAGG - Intergenic
982783274 4:159513207-159513229 AATACTATGCAGTCATAAAAAGG - Intergenic
984032768 4:174625313-174625335 AATACTATGCAGCCATAGAAAGG - Intergenic
985166312 4:187098764-187098786 AATACTATGCAGTCATAAAAAGG - Intergenic
985232547 4:187836563-187836585 AATTCTATGCAGCCATAAAAAGG - Intergenic
985239517 4:187915407-187915429 AATTCTATGCAGGCATAAAAAGG + Intergenic
986875149 5:12098239-12098261 AATACTATGCAGTCATAAAAAGG - Intergenic
986918619 5:12658252-12658274 AATACTATGCAGTCATAAAAAGG - Intergenic
986956227 5:13153541-13153563 AATACTATGCAGTCCTAAGAAGG + Intergenic
987478476 5:18422233-18422255 AATACTATGCAGTCATAAAAAGG + Intergenic
987749481 5:22020750-22020772 CATTTTATGAAGTCATGAGAGGG - Intronic
987986814 5:25157778-25157800 AATACTATGCAGCCATAGAAAGG - Intergenic
988735896 5:34020940-34020962 CATTCCAGACAGTCATAAGAAGG - Intronic
989205826 5:38808169-38808191 CAATCTATGCAGTCATGAGCTGG + Intergenic
989829657 5:45899623-45899645 AATACTATGCAGCCATAAGAAGG - Intergenic
990089843 5:52029444-52029466 AATACTATGCAGTCATAAAAAGG - Intronic
990840280 5:60071855-60071877 CATACTATGCAGCCATAAAAAGG - Intronic
993161566 5:84298286-84298308 CATACTATGCAGCCATAAAAAGG + Intronic
993323472 5:86504758-86504780 AATACTATGCAGCCATAAGAAGG + Intergenic
993959356 5:94277919-94277941 AATACTATGCAGTCATAAAAAGG + Intronic
993963604 5:94332559-94332581 AATTCTATGCAGCCATAAAAAGG - Intronic
994966546 5:106679948-106679970 AATACTATGCAGCCATAAGAAGG + Intergenic
995603505 5:113825169-113825191 CAATCTATGCCATCATAGAAAGG + Intergenic
996225118 5:120983561-120983583 AATACTATGCAGCCATAGAAAGG + Intergenic
996250749 5:121328517-121328539 AATACTATGCAGTCATAAAAAGG - Intergenic
996526481 5:124485493-124485515 AATACTATGCAGCCATAAGATGG - Intergenic
996649641 5:125858755-125858777 AATACTATGCAGTCATAAAAAGG - Intergenic
996990546 5:129625171-129625193 AATACTATGCAGTCATAAAAAGG - Intronic
997038438 5:130221732-130221754 AATACTATGCAGCCATAAGAAGG - Intergenic
999581343 5:153041748-153041770 AATACTATGCAGTCATAAAAAGG - Intergenic
999597423 5:153220670-153220692 AATTCTATGCAGCCATAAAAAGG + Intergenic
1000160507 5:158592751-158592773 AATACTATGCAGCCATAAGAAGG - Intergenic
1002894808 6:1371546-1371568 TATTGTGTGCAGTCGTAGGAAGG + Intergenic
1003686479 6:8309035-8309057 AATACTATGCAGTCATAAAAAGG - Intergenic
1004601451 6:17154372-17154394 AATTCCTTGTAGTCATAGGATGG + Intergenic
1007470501 6:42087079-42087101 CATTCTGTGAAGCCAGAGGAAGG - Intronic
1008071637 6:47104463-47104485 AATTCTAGGCAGCCAAAGGACGG - Intergenic
1009373902 6:62943595-62943617 CAGACTATGGGGTCATAGGAGGG - Intergenic
1009634720 6:66250652-66250674 AATACTATGCAGTCATAAAAAGG + Intergenic
1010038615 6:71355680-71355702 AATACTATGCAGCCATAGAAAGG - Intergenic
1010084654 6:71902862-71902884 AATACTATGCAGTCATAAAAAGG - Intronic
1010303180 6:74285192-74285214 AATACTATGCAGTCATAAAAAGG - Intergenic
1010973567 6:82288750-82288772 CATACTATGCAGCCATAAAAAGG + Intergenic
1011217529 6:85020779-85020801 AATACTATGCAGGCATAAGAAGG + Intergenic
1011816281 6:91194677-91194699 AATACTATGCAGTCATAAAAAGG - Intergenic
1012565307 6:100641820-100641842 AATACTATGCAGCCATAGAAAGG + Intronic
1013305869 6:108846798-108846820 CCTTCTAGGCTGCCATAGGAGGG - Intergenic
1013462090 6:110384578-110384600 AATACTATGCAGTCATAAAAAGG + Intergenic
1014085306 6:117335642-117335664 AATACTATGCAGCCATAAGAAGG + Intronic
1014085398 6:117336508-117336530 CATACTATGCAGCCATAAAAAGG - Intronic
1014464211 6:121735857-121735879 AATGCTATGCAGTCATAAAAAGG - Intergenic
1015659617 6:135560585-135560607 AATGCTATGCAGTCATAAAAAGG - Intergenic
1015927707 6:138326907-138326929 AATACTATGCAGTCATAAAAAGG + Intronic
1016118710 6:140320940-140320962 CATTCCTTGCTGTTATAGGAAGG - Intergenic
1016189181 6:141240075-141240097 AATACTATGCAGTCATAAAAAGG + Intergenic
1017451226 6:154556284-154556306 AATACTATGCAGACATAAGAAGG + Intergenic
1018099907 6:160428220-160428242 CTATCTATGCAGTCCCAGGAGGG - Intronic
1020620270 7:10508860-10508882 AATTCTATGCAGCCATAAAAAGG + Intergenic
1020776604 7:12461961-12461983 AATACTATGCAGTCATAAAAAGG + Intergenic
1021280358 7:18709381-18709403 CATACTATGCAGCCATAAAAAGG - Intronic
1022965956 7:35471720-35471742 CATACTATGCAGCCATAAAAAGG - Intergenic
1024615822 7:51110872-51110894 AATACTATGCAGTCATAAAAAGG - Intronic
1024923365 7:54585522-54585544 TATACTATGCATTCATTGGATGG - Intergenic
1025754435 7:64323543-64323565 AATACTATGCAGGCATAAGAAGG + Intronic
1026173142 7:67972278-67972300 AATACTATGCAGTCATAAAAAGG + Intergenic
1026604709 7:71805893-71805915 CATACTATGCAGCCATAAAAAGG + Intronic
1028112179 7:86954142-86954164 TATTATAAGCAGTCCTAGGAGGG - Intronic
1028154848 7:87418281-87418303 GATTCCCTGCAGTCACAGGATGG - Intronic
1028660637 7:93268662-93268684 GATACTATGCAGTCATAAAAAGG - Intronic
1030507176 7:110439183-110439205 AATACTATGCAGTCATAAAAAGG - Intergenic
1031189227 7:118525423-118525445 AATACTATGCAGTTATAGAAAGG - Intergenic
1032752208 7:134852589-134852611 CCTTCTAGGCAGTCATTGAATGG + Intronic
1033733080 7:144196908-144196930 CATTCTTTGAAGTCACTGGAGGG - Intergenic
1033743932 7:144295474-144295496 CATTCTTTGAAGTCACTGGAGGG - Intergenic
1033749969 7:144354080-144354102 CATTCTTTGAAGTCACTGGAGGG + Intergenic
1035908625 8:3541185-3541207 AATGCTATGCAGCCATAAGAAGG + Intronic
1036843296 8:12142741-12142763 AATACTATGCAGTCATAAAAAGG - Intergenic
1036864658 8:12385056-12385078 TATACTATGCAGTCATAAAAAGG - Intergenic
1037531533 8:19779652-19779674 CATTCTATGCTGGTACAGGACGG - Intergenic
1039024897 8:33247392-33247414 AATACTATGCAGTCATAAAAAGG - Intergenic
1039099671 8:33927936-33927958 AATACTATGCAGCCATAGAAAGG + Intergenic
1039632215 8:39124360-39124382 AATACTATGCAGTCATAAAAAGG - Intronic
1039739110 8:40363746-40363768 CATTCTAAGCAGTGAAAGAAAGG + Intergenic
1039802287 8:40969636-40969658 AATACTATGCAGCCATAAGAAGG + Intergenic
1040630753 8:49207200-49207222 AATACTATGCAGTCATAAAAAGG - Intergenic
1040739883 8:50560524-50560546 AATGCTATACAGTCATAGAAAGG + Intronic
1040917707 8:52580379-52580401 AATACTATGCAGTCATAAAAAGG - Intergenic
1040964220 8:53067773-53067795 AATACTATGCAGTCATAAAAAGG - Intergenic
1041602301 8:59734172-59734194 AATACTATGCAGTCATAAAAAGG + Intergenic
1042171230 8:65993187-65993209 AATACTATGCAGCCATAAGAAGG - Intergenic
1042523124 8:69735475-69735497 AATTCTATGCAGCCATAAAACGG + Intronic
1042976175 8:74472272-74472294 AATACTATGCAGTCATAAAAAGG - Intronic
1043419855 8:80087337-80087359 AATACTATGCAGTCATAAAAAGG + Intronic
1044222350 8:89684147-89684169 AATACTATGCAGTCATAAAAAGG + Intergenic
1044635991 8:94324680-94324702 AATACTATGCAGCCATAAGAAGG + Intergenic
1045094593 8:98784689-98784711 CAATCTATGCACACACAGGAAGG - Intronic
1046333531 8:112753423-112753445 CATTCTTTCCAGAAATAGGAAGG - Intronic
1046663521 8:116974843-116974865 TATACTATGCAGTCATAAAAAGG + Intronic
1048625791 8:136183697-136183719 CATTCCTTGCAGTCACAAGAGGG - Intergenic
1048752397 8:137694316-137694338 AATACTATGCAGTCATAAAAAGG - Intergenic
1051584284 9:18710633-18710655 CATTCCTTGCAGTCTTAGAAGGG + Intronic
1052568265 9:30186771-30186793 AATACTATGCAGTCATAAAAAGG + Intergenic
1053059455 9:35019134-35019156 AATACTATGCAGCCATAAGAAGG - Intergenic
1055585626 9:77756487-77756509 CATTCTTTGAAGTTATAGGTGGG + Intronic
1055843570 9:80534160-80534182 AATACTATGCAGCCATAGAAAGG + Intergenic
1056001479 9:82221726-82221748 AATACTATGCAGTCATAAAAGGG + Intergenic
1056314765 9:85377103-85377125 AATGCTATGCAGTCATAAAAAGG - Intergenic
1057369654 9:94458871-94458893 CATGATCTGAAGTCATAGGATGG + Intronic
1058208211 9:102134572-102134594 AATACTATGCAGCCATAAGAAGG + Intergenic
1058258593 9:102802038-102802060 AATACTATGCAGCCATAGAAAGG + Intergenic
1058844647 9:108944863-108944885 CATTTTATCCAGTGATAGCAAGG - Intronic
1059013180 9:110485240-110485262 AATACTATGCAGTCATAAAAAGG + Intronic
1059225988 9:112673436-112673458 AATACTATGCAGTCATAAAAAGG - Intergenic
1060152647 9:121298779-121298801 GATTCTGTGCAGTGCTAGGAGGG + Intronic
1203652364 Un_KI270751v1:138795-138817 TATTCTGTGCACACATAGGAAGG - Intergenic
1187107373 X:16257725-16257747 AATACTATGCAGTCATAAAAAGG - Intergenic
1188045416 X:25420687-25420709 AATACTATGCAGCCATAGAAAGG - Intergenic
1188224397 X:27579213-27579235 AATACTATGCAGCCATAGAAAGG + Intergenic
1188493739 X:30761957-30761979 AATACTATGCAGCCATAGAAAGG + Intergenic
1189526981 X:41833296-41833318 AATACTATTCAGTCATAAGAAGG + Intronic
1190821213 X:53974714-53974736 AATACTATGCAGTCATAAAAAGG + Intronic
1190942235 X:55053176-55053198 AATTCTATGCAGCCATAAAAAGG + Intergenic
1190960961 X:55247204-55247226 AATACTATGCAGCCATAGAAAGG + Intronic
1190972302 X:55362362-55362384 AATACTATGCAGTCATAAAAAGG + Intergenic
1191090696 X:56617318-56617340 AATACTATGCAGTCATAAAAAGG - Intergenic
1192367245 X:70484198-70484220 CATTCTTTGCAGCCATAGGATGG + Intronic
1192693832 X:73393383-73393405 AATACTATGCAGTCATAAAAAGG - Intergenic
1193077391 X:77369497-77369519 AATGCTATGCAGTCATAAAAAGG + Intergenic
1193314648 X:80049881-80049903 AATACTATGCAGTCATAAAAAGG - Intergenic
1193448309 X:81633919-81633941 AATACTATGCAGTCATAAAAAGG - Intergenic
1193655897 X:84197182-84197204 AATACTATGCAGTCATAAAAAGG + Intergenic
1193787816 X:85781931-85781953 CATACTATGCACTCATAAAAAGG + Intergenic
1194396516 X:93393658-93393680 AATACTATGCAGTCATAAAAAGG + Intergenic
1194446297 X:93991272-93991294 AATACTATGCAGTCATAAAAAGG + Intergenic
1194563366 X:95450080-95450102 AATACTATGCAGCCATAGAAAGG + Intergenic
1194868715 X:99100950-99100972 AATACTATGCAGTCATAAAAAGG + Intergenic
1195809359 X:108812987-108813009 AGTGCTATGCAGCCATAGGAGGG - Intergenic
1195988236 X:110656256-110656278 AATACTATGCAGCCATAGAAAGG + Intergenic
1196218531 X:113084397-113084419 AATACTATGCAGTCATAAAAAGG - Intergenic
1196465301 X:115966437-115966459 AATACTATGCAGCCATAAGAAGG + Intergenic
1196499640 X:116364820-116364842 AATTCTATGCAGCCATAAAAAGG + Intergenic
1196668445 X:118341209-118341231 TATTCTATGCAGTCCTAGTAAGG + Intergenic
1197433176 X:126391801-126391823 AATACTATGCAGCCATAGAAAGG + Intergenic
1197548205 X:127854194-127854216 AATACTATGCAGCCATAGAAAGG - Intergenic
1198246160 X:134833852-134833874 AATACTATGCAGTCATAAAAAGG - Intronic
1198560388 X:137843465-137843487 AATACTATGCAGCCATAGAAAGG - Intergenic
1198895209 X:141446487-141446509 AATACTATGCAGCCATAAGAAGG - Intergenic
1199224536 X:145357043-145357065 AATACTATGCAGCCATAGAAAGG - Intergenic
1199387995 X:147245770-147245792 AATACTATGCAGTCATAAAAAGG + Intergenic
1199935420 X:152568853-152568875 AATACTATGCAGTCACAAGAAGG + Intergenic
1201172304 Y:11280089-11280111 TATTCTGTGCACACATAGGAAGG - Intergenic
1201373543 Y:13291376-13291398 CATACTATGCAGCCATAAAATGG + Intronic
1201398562 Y:13576948-13576970 AATACTATGCAGTCATAGAAAGG + Intergenic
1201398570 Y:13577046-13577068 AATACTATGCAGCCATAGGAAGG + Intergenic
1201612528 Y:15859422-15859444 AATTCTATGCAGCCATAAAAAGG + Intergenic
1201960157 Y:19671839-19671861 AATACTATGCAGTCATAAAAAGG + Intergenic