ID: 1072260586

View in Genome Browser
Species Human (GRCh38)
Location 10:93667334-93667356
Sequence TCTACCCTCAATACAATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072260586_1072260587 -5 Left 1072260586 10:93667334-93667356 CCAGAAATTGTATTGAGGGTAGA No data
Right 1072260587 10:93667352-93667374 GTAGAGATGTCCACCACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072260586 Original CRISPR TCTACCCTCAATACAATTTC TGG (reversed) Intergenic
No off target data available for this crispr