ID: 1072260587

View in Genome Browser
Species Human (GRCh38)
Location 10:93667352-93667374
Sequence GTAGAGATGTCCACCACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072260586_1072260587 -5 Left 1072260586 10:93667334-93667356 CCAGAAATTGTATTGAGGGTAGA No data
Right 1072260587 10:93667352-93667374 GTAGAGATGTCCACCACTGAAGG No data
1072260581_1072260587 8 Left 1072260581 10:93667321-93667343 CCCTCCTTAGTCACCAGAAATTG No data
Right 1072260587 10:93667352-93667374 GTAGAGATGTCCACCACTGAAGG No data
1072260580_1072260587 9 Left 1072260580 10:93667320-93667342 CCCCTCCTTAGTCACCAGAAATT No data
Right 1072260587 10:93667352-93667374 GTAGAGATGTCCACCACTGAAGG No data
1072260582_1072260587 7 Left 1072260582 10:93667322-93667344 CCTCCTTAGTCACCAGAAATTGT No data
Right 1072260587 10:93667352-93667374 GTAGAGATGTCCACCACTGAAGG No data
1072260583_1072260587 4 Left 1072260583 10:93667325-93667347 CCTTAGTCACCAGAAATTGTATT No data
Right 1072260587 10:93667352-93667374 GTAGAGATGTCCACCACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072260587 Original CRISPR GTAGAGATGTCCACCACTGA AGG Intergenic
No off target data available for this crispr