ID: 1072265939

View in Genome Browser
Species Human (GRCh38)
Location 10:93728094-93728116
Sequence TCCAGGACTGTGCCCACCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072265935_1072265939 3 Left 1072265935 10:93728068-93728090 CCTCCCTCTCTCTTTTTCTCTCT No data
Right 1072265939 10:93728094-93728116 TCCAGGACTGTGCCCACCCTTGG No data
1072265937_1072265939 -1 Left 1072265937 10:93728072-93728094 CCTCTCTCTTTTTCTCTCTTGCT No data
Right 1072265939 10:93728094-93728116 TCCAGGACTGTGCCCACCCTTGG No data
1072265934_1072265939 4 Left 1072265934 10:93728067-93728089 CCCTCCCTCTCTCTTTTTCTCTC No data
Right 1072265939 10:93728094-93728116 TCCAGGACTGTGCCCACCCTTGG No data
1072265936_1072265939 0 Left 1072265936 10:93728071-93728093 CCCTCTCTCTTTTTCTCTCTTGC No data
Right 1072265939 10:93728094-93728116 TCCAGGACTGTGCCCACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072265939 Original CRISPR TCCAGGACTGTGCCCACCCT TGG Intergenic
No off target data available for this crispr