ID: 1072267327

View in Genome Browser
Species Human (GRCh38)
Location 10:93743236-93743258
Sequence GTAGCTATTCACAGGCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072267327_1072267329 -8 Left 1072267327 10:93743236-93743258 CCATCATGCCTGTGAATAGCTAC No data
Right 1072267329 10:93743251-93743273 ATAGCTACTGCACTCCAGCCTGG 0: 42
1: 589
2: 2430
3: 23079
4: 206498
1072267327_1072267330 -7 Left 1072267327 10:93743236-93743258 CCATCATGCCTGTGAATAGCTAC No data
Right 1072267330 10:93743252-93743274 TAGCTACTGCACTCCAGCCTGGG 0: 47
1: 1010
2: 15641
3: 186018
4: 264328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072267327 Original CRISPR GTAGCTATTCACAGGCATGA TGG (reversed) Intergenic
No off target data available for this crispr