ID: 1072267990

View in Genome Browser
Species Human (GRCh38)
Location 10:93748836-93748858
Sequence GGGGGTGCTAAGAGCATTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072267982_1072267990 10 Left 1072267982 10:93748803-93748825 CCACTGTGAGAAACTCTTTTACT No data
Right 1072267990 10:93748836-93748858 GGGGGTGCTAAGAGCATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072267990 Original CRISPR GGGGGTGCTAAGAGCATTTG GGG Intergenic
No off target data available for this crispr