ID: 1072276162

View in Genome Browser
Species Human (GRCh38)
Location 10:93825528-93825550
Sequence GGAGACTGTTGAAGTAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072276154_1072276162 19 Left 1072276154 10:93825486-93825508 CCAGTCCCAGGAGCTTGGAGGAA No data
Right 1072276162 10:93825528-93825550 GGAGACTGTTGAAGTAAGTCTGG No data
1072276156_1072276162 14 Left 1072276156 10:93825491-93825513 CCCAGGAGCTTGGAGGAAGGAGG No data
Right 1072276162 10:93825528-93825550 GGAGACTGTTGAAGTAAGTCTGG No data
1072276158_1072276162 13 Left 1072276158 10:93825492-93825514 CCAGGAGCTTGGAGGAAGGAGGC No data
Right 1072276162 10:93825528-93825550 GGAGACTGTTGAAGTAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072276162 Original CRISPR GGAGACTGTTGAAGTAAGTC TGG Intergenic
No off target data available for this crispr