ID: 1072278081

View in Genome Browser
Species Human (GRCh38)
Location 10:93842200-93842222
Sequence CAGGGTAAGCAGGCTTAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072278081_1072278089 11 Left 1072278081 10:93842200-93842222 CCATCCTAAGCCTGCTTACCCTG No data
Right 1072278089 10:93842234-93842256 TCTTCCTGCAGCAGGAATAAAGG No data
1072278081_1072278087 3 Left 1072278081 10:93842200-93842222 CCATCCTAAGCCTGCTTACCCTG No data
Right 1072278087 10:93842226-93842248 CACCTGCTTCTTCCTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072278081 Original CRISPR CAGGGTAAGCAGGCTTAGGA TGG (reversed) Intergenic
No off target data available for this crispr