ID: 1072280842

View in Genome Browser
Species Human (GRCh38)
Location 10:93863854-93863876
Sequence CAGGATAAAGAATGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072280842_1072280851 22 Left 1072280842 10:93863854-93863876 CCTTCTTCCCATTCTTTATCCTG No data
Right 1072280851 10:93863899-93863921 CTCTAAGAACATCAGTACACAGG No data
1072280842_1072280847 -10 Left 1072280842 10:93863854-93863876 CCTTCTTCCCATTCTTTATCCTG No data
Right 1072280847 10:93863867-93863889 CTTTATCCTGATGTGGGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072280842 Original CRISPR CAGGATAAAGAATGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr