ID: 1072283636

View in Genome Browser
Species Human (GRCh38)
Location 10:93893289-93893311
Sequence ATCTTACATCTGGCCAAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072283631_1072283636 28 Left 1072283631 10:93893238-93893260 CCTGGGCCAAAGAATATATTTTA No data
Right 1072283636 10:93893289-93893311 ATCTTACATCTGGCCAAATTAGG No data
1072283634_1072283636 5 Left 1072283634 10:93893261-93893283 CCAGGTCTAATTACATCAGATTA No data
Right 1072283636 10:93893289-93893311 ATCTTACATCTGGCCAAATTAGG No data
1072283633_1072283636 22 Left 1072283633 10:93893244-93893266 CCAAAGAATATATTTTACCAGGT No data
Right 1072283636 10:93893289-93893311 ATCTTACATCTGGCCAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072283636 Original CRISPR ATCTTACATCTGGCCAAATT AGG Intergenic
No off target data available for this crispr